Mutagenetix > Incidental Mutations

Incidental Mutation 'R5120:Large1'

392938

Institutional Source

Beutler Lab

Gene Symbol

Large1

Ensembl Gene

ENSMUSG00000004383

Gene Name

LARGE xylosyl- and glucuronyltransferase 1

Synonyms

froggy, BPFD#36, fg, enr

MMRRC Submission

042708-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.588) question?

Stock #

R5120 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72814599-73353540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 72859341 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 379 (I379N)

Ref Sequence

ENSEMBL: ENSMUSP00000148336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004497] [ENSMUST00000119826] [ENSMUST00000212459]

AlphaFold

Q9Z1M7

Predicted Effect

probably damaging
Transcript: ENSMUST00000004497
AA Change: I379N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000004497
Gene: ENSMUSG00000004383
AA Change: I379N

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
coiled coil region	55	90	N/A	INTRINSIC
Pfam:Glyco_transf_8	141	387	6.2e-22	PFAM
Pfam:Glyco_transf_49	473	540	5.2e-15	PFAM
Pfam:Glyco_transf_49	535	743	1.1e-47	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000119826
AA Change: I379N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000112617
Gene: ENSMUSG00000004383
AA Change: I379N

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
coiled coil region	55	90	N/A	INTRINSIC
Pfam:Glyco_transf_8	142	386	3e-23	PFAM
Pfam:Glyco_transf_49	473	540	2.3e-11	PFAM
Pfam:Glyco_transf_49	520	743	2.7e-44	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000212459
AA Change: I379N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Meta Mutation Damage Score

0.9421

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.8%
20x: 90.6%

Validation Efficiency

100% (97/97)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes exhibit a progressive myopathy, abnormal posture, thoracic kyphosis, calcium deposits in muscle, loss of Schwann cells and myelin, eye and CNS defects, deafness, reduced growth, and death around 4 months. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310033P09Rik	A	G	11: 59,210,235	H225R	probably benign	Het
Abcc9	T	A	6: 142,656,618	I690F	probably benign	Het
Acp4	A	T	7: 44,256,971	D52E	probably damaging	Het
Adam17	T	C	12: 21,343,019		probably benign	Het
Adamts15	T	C	9: 30,921,576	E221G	probably damaging	Het
Aoc2	A	G	11: 101,325,714	T208A	probably benign	Het
Apoa4	T	G	9: 46,242,737	I212S	probably damaging	Het
Bptf	A	T	11: 107,073,385	M1598K	probably damaging	Het
Camsap3	G	A	8: 3,600,680	R209Q	probably damaging	Het
Ccdc171	C	A	4: 83,558,526		probably benign	Het
Celsr2	G	C	3: 108,393,120	P2875A	probably benign	Het
Cenpb	A	G	2: 131,179,818	V20A	probably benign	Het
Cfap61	A	T	2: 146,143,160	K975*	probably null	Het
Col9a2	G	T	4: 121,039,772	A20S	unknown	Het
Crnn	A	T	3: 93,148,896	I330F	probably benign	Het
Csf3r	C	A	4: 126,035,827	P381Q	probably benign	Het
Csmd3	G	A	15: 48,673,495	Q104*	probably null	Het
Ctnna1	G	A	18: 35,182,554		probably null	Het
Cwf19l2	C	T	9: 3,418,761	Q183*	probably null	Het
Ddx60	T	C	8: 61,945,906	Y220H	probably benign	Het
Dhh	T	C	15: 98,898,157	Q39R	probably benign	Het
Dynlrb2	T	A	8: 116,515,698	I89N	possibly damaging	Het
Dytn	T	C	1: 63,623,043	E645G	probably benign	Het
Efcab7	A	G	4: 99,897,491	T287A	probably damaging	Het
Eogt	A	G	6: 97,134,315	V195A	probably benign	Het
Ep400	G	T	5: 110,756,358	P125Q	probably damaging	Het
Fasn	A	G	11: 120,811,391	V1815A	probably benign	Het
Gm4788	T	C	1: 139,753,103	S226G	probably benign	Het
Gm5866	T	C	5: 52,582,882		noncoding transcript	Het
Gm8674	C	A	13: 49,901,948		noncoding transcript	Het
Gpat4	G	T	8: 23,180,202	H270Q	possibly damaging	Het
Grik5	A	G	7: 25,010,640	L890P	probably damaging	Het
Gsap	A	G	5: 21,269,936	N500S	probably damaging	Het
H2-M10.1	T	C	17: 36,325,156	D173G	probably benign	Het
Igfn1	T	A	1: 135,973,502	I413F	possibly damaging	Het
Ighv1-52	G	T	12: 115,145,786	H17N	probably benign	Het
Kcnu1	T	A	8: 25,934,488	D270E	possibly damaging	Het
Kif16b	A	C	2: 142,848,339	N274K	probably damaging	Het
Klk1b11	C	T	7: 43,999,022	T151I	probably benign	Het
Krtap13	A	G	16: 88,751,570	F10S	probably damaging	Het
Lhx8	T	C	3: 154,311,695	H301R	probably damaging	Het
Lrriq3	T	C	3: 155,129,384	V252A	probably benign	Het
Lysmd3	T	A	13: 81,669,192	I96N	probably damaging	Het
Mpeg1	C	T	19: 12,461,429	Q84*	probably null	Het
Myoz1	C	T	14: 20,650,654	G165D	probably benign	Het
Myt1	G	A	2: 181,797,620	V312I	probably benign	Het
Ndufb7	T	C	8: 83,566,977		probably benign	Het
Numa1	C	T	7: 101,977,437	T10M	probably damaging	Het
Olfr1285	T	C	2: 111,409,240		noncoding transcript	Het
Olfr130	A	T	17: 38,067,266	I32F	probably damaging	Het
Olfr1316	A	T	2: 112,130,558	D84E	probably damaging	Het
Olfr149	T	A	9: 39,702,070	H233L	probably benign	Het
Olfr390	A	C	11: 73,786,964	I9L	probably benign	Het
Osmr	A	T	15: 6,827,275	S464T	probably benign	Het
Pak7	G	A	2: 136,083,229	H718Y	probably damaging	Het
Pan2	T	A	10: 128,314,995		probably null	Het
Pik3r4	T	C	9: 105,669,009	S853P	probably benign	Het
Pnkp	C	T	7: 44,862,403	S113L	probably damaging	Het
Polr3gl	T	A	3: 96,578,479		probably benign	Het
Psd2	G	A	18: 35,979,810	R186Q	possibly damaging	Het
Psd4	T	C	2: 24,405,438	V868A	probably benign	Het
Ralgapa2	G	T	2: 146,412,084	T852K	probably benign	Het
Rbm43	T	C	2: 51,932,423		probably benign	Het
Rps6kl1	C	A	12: 85,139,348	G329C	probably damaging	Het
Scaf11	T	C	15: 96,419,542	T714A	probably benign	Het
Selenoo	C	A	15: 89,094,305	N310K	possibly damaging	Het
Sepsecs	T	C	5: 52,660,661	Q258R	probably damaging	Het
Sgcz	T	C	8: 37,526,266	S226G	probably benign	Het
Slfn5	A	G	11: 82,960,928	K627E	probably damaging	Het
Sos1	A	T	17: 80,408,248	F1027I	probably damaging	Het
Ssh1	C	G	5: 113,957,398	V228L	possibly damaging	Het
Sugp1	C	A	8: 70,048,667	P65T	probably benign	Het
Tas2r106	T	A	6: 131,678,816	N24I	probably damaging	Het
Tex10	T	C	4: 48,459,272	E534G	possibly damaging	Het
Tmem182	C	T	1: 40,854,901	T192I	possibly damaging	Het
Traf7	T	A	17: 24,518,744	K51*	probably null	Het
Trap1	C	A	16: 4,044,088	R604L	probably damaging	Het
Trim6	T	A	7: 104,228,240	L179Q	probably damaging	Het
Ubfd1	T	C	7: 122,071,750	S264P	probably damaging	Het
Upk3bl	T	C	5: 136,064,191		probably benign	Het
Wdfy3	T	A	5: 101,868,106	Q2601L	possibly damaging	Het
Wdr89	A	G	12: 75,632,638	Y281H	probably damaging	Het
Zfp286	A	T	11: 62,780,725	M174K	probably benign	Het
Zmym1	T	C	4: 127,051,437		probably null	Het

Other mutations in Large1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Large1	APN	8	72837497	missense	probably damaging	1.00
IGL00326:Large1	APN	8	73131983	missense	probably benign
IGL00418:Large1	APN	8	72823841	critical splice acceptor site	probably null
IGL01155:Large1	APN	8	73131989	missense	probably benign	0.01
IGL01793:Large1	APN	8	72859181	splice site	probably benign
IGL01929:Large1	APN	8	72859275	missense	probably damaging	1.00
IGL02218:Large1	APN	8	72912122	missense	probably damaging	1.00
IGL02276:Large1	APN	8	72818093	missense	probably benign	0.00
IGL02329:Large1	APN	8	73048317	missense	possibly damaging	0.80
IGL02543:Large1	APN	8	73048414	missense	probably benign	0.00
IGL02887:Large1	APN	8	73132039	missense	probably benign	0.07
biggs	UTSW	8	73116419	missense	probably damaging	1.00
umber	UTSW	8	72883264	nonsense	probably null
R0179:Large1	UTSW	8	73098846	missense	probably benign	0.09
R0477:Large1	UTSW	8	72818082	missense	probably damaging	1.00
R0587:Large1	UTSW	8	72859333	missense	probably damaging	1.00
R0791:Large1	UTSW	8	73048479	splice site	probably benign
R1253:Large1	UTSW	8	73048422	missense	probably damaging	0.98
R1695:Large1	UTSW	8	72818082	missense	probably damaging	1.00
R2017:Large1	UTSW	8	72852197	missense	probably damaging	1.00
R4835:Large1	UTSW	8	73048347	missense	probably damaging	1.00
R5105:Large1	UTSW	8	72852244	nonsense	probably null
R5135:Large1	UTSW	8	72818096	missense	probably benign	0.38
R5137:Large1	UTSW	8	73048309	missense	possibly damaging	0.58
R5567:Large1	UTSW	8	72837453	missense	possibly damaging	0.93
R5945:Large1	UTSW	8	72852200	missense	probably damaging	0.99
R6619:Large1	UTSW	8	72883264	nonsense	probably null
R6951:Large1	UTSW	8	73116419	missense	probably damaging	1.00
R7041:Large1	UTSW	8	73116464	missense	probably damaging	0.98
R7300:Large1	UTSW	8	72837596	missense	probably damaging	1.00
R7493:Large1	UTSW	8	72823715	missense	probably benign	0.23
R7877:Large1	UTSW	8	73116443	missense	probably damaging	1.00
R8118:Large1	UTSW	8	73131944	missense	probably benign	0.40
R8129:Large1	UTSW	8	72815957	missense	probably damaging	1.00
R8525:Large1	UTSW	8	72837492	missense	probably damaging	1.00
R8963:Large1	UTSW	8	72815984	missense	probably damaging	1.00
R9170:Large1	UTSW	8	72816017	missense	probably benign	0.00
Z1088:Large1	UTSW	8	72912103	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCTGGATGTAGTACCCAACAAGG -3'
(R):5'- AGGCAAACTTGGTTCTATCCCC -3'

Sequencing Primer
(F):5'- AGAGTATGGCCAATCTCCCTGATG -3'
(R):5'- AAACTTGGTTCTATCCCCAGCAC -3'

Posted On

2016-06-15