Incidental Mutation 'R5120:Wdr89'
ID 392954
Institutional Source Beutler Lab
Gene Symbol Wdr89
Ensembl Gene ENSMUSG00000045690
Gene Name WD repeat domain 89
Synonyms 2600001A11Rik
MMRRC Submission 042708-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5120 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 75677370-75716311 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75679412 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 281 (Y281H)
Ref Sequence ENSEMBL: ENSMUSP00000140172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062370] [ENSMUST00000187307]
AlphaFold Q9D0R9
Predicted Effect probably damaging
Transcript: ENSMUST00000062370
AA Change: Y281H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050532
Gene: ENSMUSG00000045690
AA Change: Y281H

DomainStartEndE-ValueType
WD40 20 56 3.82e1 SMART
WD40 59 98 1.85e-3 SMART
WD40 103 147 2.64e2 SMART
WD40 157 198 6.38e-7 SMART
WD40 205 244 1.1e2 SMART
WD40 308 348 1.82e-2 SMART
low complexity region 366 379 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185426
Predicted Effect probably damaging
Transcript: ENSMUST00000187307
AA Change: Y281H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140172
Gene: ENSMUSG00000045690
AA Change: Y281H

DomainStartEndE-ValueType
WD40 20 56 3.82e1 SMART
WD40 59 98 1.85e-3 SMART
WD40 103 147 2.64e2 SMART
WD40 157 198 6.38e-7 SMART
WD40 205 244 1.1e2 SMART
WD40 308 348 1.82e-2 SMART
low complexity region 366 379 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191005
Meta Mutation Damage Score 0.4313 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 100% (97/97)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,101,061 (GRCm39) H225R probably benign Het
Abcc9 T A 6: 142,602,344 (GRCm39) I690F probably benign Het
Acp4 A T 7: 43,906,395 (GRCm39) D52E probably damaging Het
Adam17 T C 12: 21,393,020 (GRCm39) probably benign Het
Adamts15 T C 9: 30,832,872 (GRCm39) E221G probably damaging Het
Aoc2 A G 11: 101,216,540 (GRCm39) T208A probably benign Het
Apoa4 T G 9: 46,154,035 (GRCm39) I212S probably damaging Het
Bptf A T 11: 106,964,211 (GRCm39) M1598K probably damaging Het
Camsap3 G A 8: 3,650,680 (GRCm39) R209Q probably damaging Het
Ccdc171 C A 4: 83,476,763 (GRCm39) probably benign Het
Celsr2 G C 3: 108,300,436 (GRCm39) P2875A probably benign Het
Cenpb A G 2: 131,021,738 (GRCm39) V20A probably benign Het
Cfap61 A T 2: 145,985,080 (GRCm39) K975* probably null Het
Cfhr4 T C 1: 139,680,841 (GRCm39) S226G probably benign Het
Col9a2 G T 4: 120,896,969 (GRCm39) A20S unknown Het
Crnn A T 3: 93,056,203 (GRCm39) I330F probably benign Het
Csf3r C A 4: 125,929,620 (GRCm39) P381Q probably benign Het
Csmd3 G A 15: 48,536,891 (GRCm39) Q104* probably null Het
Ctnna1 G A 18: 35,315,607 (GRCm39) probably null Het
Cwf19l2 C T 9: 3,418,761 (GRCm39) Q183* probably null Het
Ddx60 T C 8: 62,398,940 (GRCm39) Y220H probably benign Het
Dhh T C 15: 98,796,038 (GRCm39) Q39R probably benign Het
Dynlrb2 T A 8: 117,242,437 (GRCm39) I89N possibly damaging Het
Dytn T C 1: 63,662,202 (GRCm39) E645G probably benign Het
Efcab7 A G 4: 99,754,688 (GRCm39) T287A probably damaging Het
Eogt A G 6: 97,111,276 (GRCm39) V195A probably benign Het
Ep400 G T 5: 110,904,224 (GRCm39) P125Q probably damaging Het
Fasn A G 11: 120,702,217 (GRCm39) V1815A probably benign Het
Gm5866 T C 5: 52,740,224 (GRCm39) noncoding transcript Het
Gm8674 C A 13: 50,055,984 (GRCm39) noncoding transcript Het
Gpat4 G T 8: 23,670,218 (GRCm39) H270Q possibly damaging Het
Grik5 A G 7: 24,710,065 (GRCm39) L890P probably damaging Het
Gsap A G 5: 21,474,934 (GRCm39) N500S probably damaging Het
H2-M10.1 T C 17: 36,636,048 (GRCm39) D173G probably benign Het
Igfn1 T A 1: 135,901,240 (GRCm39) I413F possibly damaging Het
Ighv1-52 G T 12: 115,109,406 (GRCm39) H17N probably benign Het
Kcnu1 T A 8: 26,424,516 (GRCm39) D270E possibly damaging Het
Kif16b A C 2: 142,690,259 (GRCm39) N274K probably damaging Het
Klk1b11 C T 7: 43,648,446 (GRCm39) T151I probably benign Het
Krtap13 A G 16: 88,548,458 (GRCm39) F10S probably damaging Het
Large1 A T 8: 73,585,969 (GRCm39) I379N probably damaging Het
Lhx8 T C 3: 154,017,332 (GRCm39) H301R probably damaging Het
Lrriq3 T C 3: 154,835,021 (GRCm39) V252A probably benign Het
Lysmd3 T A 13: 81,817,311 (GRCm39) I96N probably damaging Het
Mpeg1 C T 19: 12,438,793 (GRCm39) Q84* probably null Het
Myoz1 C T 14: 20,700,722 (GRCm39) G165D probably benign Het
Myt1 G A 2: 181,439,413 (GRCm39) V312I probably benign Het
Ndufb7 T C 8: 84,293,606 (GRCm39) probably benign Het
Numa1 C T 7: 101,626,644 (GRCm39) T10M probably damaging Het
Or10d1b T A 9: 39,613,366 (GRCm39) H233L probably benign Het
Or1e30 A C 11: 73,677,790 (GRCm39) I9L probably benign Het
Or2g7 A T 17: 38,378,157 (GRCm39) I32F probably damaging Het
Or4f14d A T 2: 111,960,903 (GRCm39) D84E probably damaging Het
Or4k39 T C 2: 111,239,585 (GRCm39) noncoding transcript Het
Osmr A T 15: 6,856,756 (GRCm39) S464T probably benign Het
Pak5 G A 2: 135,925,149 (GRCm39) H718Y probably damaging Het
Pan2 T A 10: 128,150,864 (GRCm39) probably null Het
Pik3r4 T C 9: 105,546,208 (GRCm39) S853P probably benign Het
Pnkp C T 7: 44,511,827 (GRCm39) S113L probably damaging Het
Polr3gl T A 3: 96,485,795 (GRCm39) probably benign Het
Psd2 G A 18: 36,112,863 (GRCm39) R186Q possibly damaging Het
Psd4 T C 2: 24,295,450 (GRCm39) V868A probably benign Het
Ralgapa2 G T 2: 146,254,004 (GRCm39) T852K probably benign Het
Rbm43 T C 2: 51,822,435 (GRCm39) probably benign Het
Rps6kl1 C A 12: 85,186,122 (GRCm39) G329C probably damaging Het
Scaf11 T C 15: 96,317,423 (GRCm39) T714A probably benign Het
Selenoo C A 15: 88,978,508 (GRCm39) N310K possibly damaging Het
Sepsecs T C 5: 52,818,003 (GRCm39) Q258R probably damaging Het
Sgcz T C 8: 37,993,420 (GRCm39) S226G probably benign Het
Slfn5 A G 11: 82,851,754 (GRCm39) K627E probably damaging Het
Sos1 A T 17: 80,715,677 (GRCm39) F1027I probably damaging Het
Ssh1 C G 5: 114,095,459 (GRCm39) V228L possibly damaging Het
Sugp1 C A 8: 70,501,317 (GRCm39) P65T probably benign Het
Tas2r106 T A 6: 131,655,779 (GRCm39) N24I probably damaging Het
Tex10 T C 4: 48,459,272 (GRCm39) E534G possibly damaging Het
Tmem182 C T 1: 40,894,061 (GRCm39) T192I possibly damaging Het
Traf7 T A 17: 24,737,718 (GRCm39) K51* probably null Het
Trap1 C A 16: 3,861,952 (GRCm39) R604L probably damaging Het
Trim6 T A 7: 103,877,447 (GRCm39) L179Q probably damaging Het
Ubfd1 T C 7: 121,670,973 (GRCm39) S264P probably damaging Het
Upk3bl T C 5: 136,093,045 (GRCm39) probably benign Het
Wdfy3 T A 5: 102,015,972 (GRCm39) Q2601L possibly damaging Het
Zfp286 A T 11: 62,671,551 (GRCm39) M174K probably benign Het
Zmym1 T C 4: 126,945,230 (GRCm39) probably null Het
Other mutations in Wdr89
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Wdr89 APN 12 75,679,825 (GRCm39) nonsense probably null
IGL02176:Wdr89 APN 12 75,679,897 (GRCm39) missense probably damaging 0.96
IGL02472:Wdr89 APN 12 75,679,743 (GRCm39) missense probably damaging 1.00
IGL02973:Wdr89 APN 12 75,679,873 (GRCm39) missense probably damaging 0.98
R0003:Wdr89 UTSW 12 75,679,367 (GRCm39) missense probably benign 0.00
R2060:Wdr89 UTSW 12 75,679,762 (GRCm39) missense probably damaging 1.00
R4494:Wdr89 UTSW 12 75,679,521 (GRCm39) missense probably damaging 1.00
R5195:Wdr89 UTSW 12 75,680,062 (GRCm39) missense probably benign 0.23
R6572:Wdr89 UTSW 12 75,680,159 (GRCm39) missense probably damaging 1.00
R7487:Wdr89 UTSW 12 75,679,388 (GRCm39) missense probably benign
R7835:Wdr89 UTSW 12 75,679,673 (GRCm39) missense probably damaging 1.00
R8445:Wdr89 UTSW 12 75,679,636 (GRCm39) missense probably damaging 0.99
R8765:Wdr89 UTSW 12 75,679,688 (GRCm39) missense probably damaging 1.00
R9202:Wdr89 UTSW 12 75,679,943 (GRCm39) missense probably benign 0.00
R9269:Wdr89 UTSW 12 75,679,564 (GRCm39) missense possibly damaging 0.50
R9340:Wdr89 UTSW 12 75,679,937 (GRCm39) missense probably benign 0.11
R9522:Wdr89 UTSW 12 75,679,924 (GRCm39) missense probably damaging 1.00
R9557:Wdr89 UTSW 12 75,679,666 (GRCm39) missense probably damaging 1.00
R9760:Wdr89 UTSW 12 75,680,026 (GRCm39) missense probably damaging 0.99
X0023:Wdr89 UTSW 12 75,679,951 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGGTTTCCACAGCAATAGC -3'
(R):5'- CGTTTCATCAGTGAGCTGTATCG -3'

Sequencing Primer
(F):5'- GCAATAGCTGTGCATCTTCAC -3'
(R):5'- CATCAGTGAGCTGTATCGGTTGG -3'
Posted On 2016-06-15