Incidental Mutation 'R5120:Ctnna1'
ID392969
Institutional Source Beutler Lab
Gene Symbol Ctnna1
Ensembl Gene ENSMUSG00000037815
Gene Namecatenin (cadherin associated protein), alpha 1
Synonymsalpha E catenin, alpha(E)-catenin, 2010010M04Rik, Catna1
MMRRC Submission 042708-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5120 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location35118888-35254773 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 35182554 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000049007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042345]
PDB Structure
CRYSTAL STRUCTURE OF THE ALPHA-CATENIN DIMERIZATION DOMAIN [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF A CHIMERA OF BETA-CATENIN AND ALPHA-CATENIN [X-RAY DIFFRACTION]
alpha-catenin fragment, residues 385-651 [X-RAY DIFFRACTION]
Alpha-E-catenin is an autoinhibited molecule that co-activates vinculin [X-RAY DIFFRACTION]
Alpha-E-catenin is an autoinhibited molecule that co-activates vinculin [X-RAY DIFFRACTION]
Crystal structure of full-length mouse alphaE-catenin [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000042345
SMART Domains Protein: ENSMUSP00000049007
Gene: ENSMUSG00000037815

DomainStartEndE-ValueType
Pfam:Vinculin 19 339 2.6e-99 PFAM
Pfam:Vinculin 333 867 3.3e-218 PFAM
Meta Mutation Damage Score 0.9595 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 100% (97/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the catenin family of proteins that play an important role in cell adhesion process by connecting cadherins located on the plasma membrane to the actin filaments inside the cell. The encoded mechanosensing protein contains three vinculin homology domains and undergoes conformational changes in response to cytoskeletal tension, resulting in the reconfiguration of cadherin-actin filament connections. Certain mutations in this gene cause butterfly-shaped pigment dystrophy. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at the blastocyst stage. A conditional knockout in surface epithelium results in defects in hair follicle development and epidermal morphogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,210,235 H225R probably benign Het
Abcc9 T A 6: 142,656,618 I690F probably benign Het
Acp4 A T 7: 44,256,971 D52E probably damaging Het
Adam17 T C 12: 21,343,019 probably benign Het
Adamts15 T C 9: 30,921,576 E221G probably damaging Het
Aoc2 A G 11: 101,325,714 T208A probably benign Het
Apoa4 T G 9: 46,242,737 I212S probably damaging Het
Bptf A T 11: 107,073,385 M1598K probably damaging Het
Camsap3 G A 8: 3,600,680 R209Q probably damaging Het
Ccdc171 C A 4: 83,558,526 probably benign Het
Celsr2 G C 3: 108,393,120 P2875A probably benign Het
Cenpb A G 2: 131,179,818 V20A probably benign Het
Cfap61 A T 2: 146,143,160 K975* probably null Het
Col9a2 G T 4: 121,039,772 A20S unknown Het
Crnn A T 3: 93,148,896 I330F probably benign Het
Csf3r C A 4: 126,035,827 P381Q probably benign Het
Csmd3 G A 15: 48,673,495 Q104* probably null Het
Cwf19l2 C T 9: 3,418,761 Q183* probably null Het
Ddx60 T C 8: 61,945,906 Y220H probably benign Het
Dhh T C 15: 98,898,157 Q39R probably benign Het
Dynlrb2 T A 8: 116,515,698 I89N possibly damaging Het
Dytn T C 1: 63,623,043 E645G probably benign Het
Efcab7 A G 4: 99,897,491 T287A probably damaging Het
Eogt A G 6: 97,134,315 V195A probably benign Het
Ep400 G T 5: 110,756,358 P125Q probably damaging Het
Fasn A G 11: 120,811,391 V1815A probably benign Het
Gm4788 T C 1: 139,753,103 S226G probably benign Het
Gm5866 T C 5: 52,582,882 noncoding transcript Het
Gm8674 C A 13: 49,901,948 noncoding transcript Het
Gpat4 G T 8: 23,180,202 H270Q possibly damaging Het
Grik5 A G 7: 25,010,640 L890P probably damaging Het
Gsap A G 5: 21,269,936 N500S probably damaging Het
H2-M10.1 T C 17: 36,325,156 D173G probably benign Het
Igfn1 T A 1: 135,973,502 I413F possibly damaging Het
Ighv1-52 G T 12: 115,145,786 H17N probably benign Het
Kcnu1 T A 8: 25,934,488 D270E possibly damaging Het
Kif16b A C 2: 142,848,339 N274K probably damaging Het
Klk1b11 C T 7: 43,999,022 T151I probably benign Het
Krtap13 A G 16: 88,751,570 F10S probably damaging Het
Large1 A T 8: 72,859,341 I379N probably damaging Het
Lhx8 T C 3: 154,311,695 H301R probably damaging Het
Lrriq3 T C 3: 155,129,384 V252A probably benign Het
Lysmd3 T A 13: 81,669,192 I96N probably damaging Het
Mpeg1 C T 19: 12,461,429 Q84* probably null Het
Myoz1 C T 14: 20,650,654 G165D probably benign Het
Myt1 G A 2: 181,797,620 V312I probably benign Het
Ndufb7 T C 8: 83,566,977 probably benign Het
Numa1 C T 7: 101,977,437 T10M probably damaging Het
Olfr1285 T C 2: 111,409,240 noncoding transcript Het
Olfr130 A T 17: 38,067,266 I32F probably damaging Het
Olfr1316 A T 2: 112,130,558 D84E probably damaging Het
Olfr149 T A 9: 39,702,070 H233L probably benign Het
Olfr390 A C 11: 73,786,964 I9L probably benign Het
Osmr A T 15: 6,827,275 S464T probably benign Het
Pak7 G A 2: 136,083,229 H718Y probably damaging Het
Pan2 T A 10: 128,314,995 probably null Het
Pik3r4 T C 9: 105,669,009 S853P probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Polr3gl T A 3: 96,578,479 probably benign Het
Psd2 G A 18: 35,979,810 R186Q possibly damaging Het
Psd4 T C 2: 24,405,438 V868A probably benign Het
Ralgapa2 G T 2: 146,412,084 T852K probably benign Het
Rbm43 T C 2: 51,932,423 probably benign Het
Rps6kl1 C A 12: 85,139,348 G329C probably damaging Het
Scaf11 T C 15: 96,419,542 T714A probably benign Het
Selenoo C A 15: 89,094,305 N310K possibly damaging Het
Sepsecs T C 5: 52,660,661 Q258R probably damaging Het
Sgcz T C 8: 37,526,266 S226G probably benign Het
Slfn5 A G 11: 82,960,928 K627E probably damaging Het
Sos1 A T 17: 80,408,248 F1027I probably damaging Het
Ssh1 C G 5: 113,957,398 V228L possibly damaging Het
Sugp1 C A 8: 70,048,667 P65T probably benign Het
Tas2r106 T A 6: 131,678,816 N24I probably damaging Het
Tex10 T C 4: 48,459,272 E534G possibly damaging Het
Tmem182 C T 1: 40,854,901 T192I possibly damaging Het
Traf7 T A 17: 24,518,744 K51* probably null Het
Trap1 C A 16: 4,044,088 R604L probably damaging Het
Trim6 T A 7: 104,228,240 L179Q probably damaging Het
Ubfd1 T C 7: 122,071,750 S264P probably damaging Het
Upk3bl T C 5: 136,064,191 probably benign Het
Wdfy3 T A 5: 101,868,106 Q2601L possibly damaging Het
Wdr89 A G 12: 75,632,638 Y281H probably damaging Het
Zfp286 A T 11: 62,780,725 M174K probably benign Het
Zmym1 T C 4: 127,051,437 probably null Het
Other mutations in Ctnna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Ctnna1 APN 18 35223448 missense probably damaging 0.97
IGL03068:Ctnna1 APN 18 35249732 missense possibly damaging 0.66
IGL03286:Ctnna1 APN 18 35175153 missense probably benign 0.37
PIT4458001:Ctnna1 UTSW 18 35175126 missense possibly damaging 0.65
R0282:Ctnna1 UTSW 18 35244122 missense possibly damaging 0.79
R1971:Ctnna1 UTSW 18 35154527 missense probably benign
R2117:Ctnna1 UTSW 18 35152625 missense possibly damaging 0.76
R2424:Ctnna1 UTSW 18 35253707 missense probably benign 0.00
R4602:Ctnna1 UTSW 18 35179827 missense possibly damaging 0.92
R4812:Ctnna1 UTSW 18 35239477 missense probably damaging 1.00
R5469:Ctnna1 UTSW 18 35239520 missense probably benign 0.00
R5607:Ctnna1 UTSW 18 35249742 missense probably benign 0.25
R5629:Ctnna1 UTSW 18 35249749 missense probably benign
R5824:Ctnna1 UTSW 18 35179886 missense probably benign
R5971:Ctnna1 UTSW 18 35154514 missense probably benign
R6191:Ctnna1 UTSW 18 35174355 missense probably damaging 1.00
R7065:Ctnna1 UTSW 18 35152616 missense probably benign
R7519:Ctnna1 UTSW 18 35174371 missense probably benign 0.02
R7624:Ctnna1 UTSW 18 35244844 missense probably benign 0.00
R7636:Ctnna1 UTSW 18 35223473 missense possibly damaging 0.92
U15987:Ctnna1 UTSW 18 35154514 missense probably benign
X0021:Ctnna1 UTSW 18 35182545 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTGTGGACCCCTTGAGCTTC -3'
(R):5'- CAACAGACATGGTGTTTTCTATGG -3'

Sequencing Primer
(F):5'- ATCCTGCACACGTGATG -3'
(R):5'- TAGACAAGTCTCTTACTGAGCCAGG -3'
Posted On2016-06-15