Incidental Mutation 'R5121:Peg3'
ID 393016
Institutional Source Beutler Lab
Gene Symbol Peg3
Ensembl Gene ENSMUSG00000002265
Gene Name paternally expressed 3
Synonyms Zfp102, Gcap4, Pw1, End4
MMRRC Submission 042709-MU
Accession Numbers

Genbank: NM_008817; MGI: 104748

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5121 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 6703892-6730431 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 6710289 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 645 (K645E)
Ref Sequence ENSEMBL: ENSMUSP00000050750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051209] [ENSMUST00000143703] [ENSMUST00000150182]
AlphaFold Q3URU2
Predicted Effect probably benign
Transcript: ENSMUST00000051209
AA Change: K645E

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000050750
Gene: ENSMUSG00000002265
AA Change: K645E

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 213 221 N/A INTRINSIC
ZnF_C2H2 325 347 7.26e-3 SMART
ZnF_C2H2 378 400 6.88e-4 SMART
ZnF_C2H2 436 458 2.95e-3 SMART
low complexity region 464 496 N/A INTRINSIC
ZnF_C2H2 520 542 5.99e-4 SMART
low complexity region 691 698 N/A INTRINSIC
ZnF_C2H2 850 872 2.99e-4 SMART
ZnF_C2H2 1091 1113 2.05e-2 SMART
ZnF_C2H2 1147 1169 1.04e-3 SMART
ZnF_C2H2 1209 1231 1.38e-3 SMART
ZnF_C2H2 1266 1289 1.89e-1 SMART
ZnF_C2H2 1317 1339 1.57e2 SMART
low complexity region 1373 1419 N/A INTRINSIC
low complexity region 1440 1486 N/A INTRINSIC
ZnF_C2H2 1488 1510 2.2e-2 SMART
ZnF_C2H2 1547 1569 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143703
SMART Domains Protein: ENSMUSP00000122423
Gene: ENSMUSG00000002265

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150182
SMART Domains Protein: ENSMUSP00000116161
Gene: ENSMUSG00000002265

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, ZIM2 and PEG3 are treated as two distinct genes though they share multiple 5' exons and a common promoter and both genes are paternally expressed (PMID:15203203). Alternative splicing events connect their shared 5' exons either with the remaining 4 exons unique to ZIM2, or with the remaining 2 exons unique to PEG3. In contrast, in other mammals ZIM2 does not undergo imprinting and, in mouse, cow, and likely other mammals as well, the ZIM2 and PEG3 genes do not share exons. Human PEG3 protein belongs to the Kruppel C2H2-type zinc finger protein family. PEG3 may play a role in cell proliferation and p53-mediated apoptosis. PEG3 has also shown tumor suppressor activity and tumorigenesis in glioma and ovarian cells. Alternative splicing of this PEG3 gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2009]
PHENOTYPE: Heterozygous mutant females exhibit growth retardation, impaired maternal behavior and diminished milk ejection, and fewer oxytocin neurons. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Gene trapped(3)

Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c A G 2: 58,281,650 I234T probably damaging Het
Adam24 A G 8: 40,679,511 E6G probably damaging Het
Amz1 A G 5: 140,744,164 D151G probably benign Het
Arhgap24 T C 5: 102,841,335 L10P probably damaging Het
Arhgap25 T G 6: 87,532,864 N8T probably benign Het
Arsi T G 18: 60,917,439 F465V probably damaging Het
Atp2c1 A G 9: 105,448,825 V293A probably damaging Het
Bzw2 A G 12: 36,104,351 L340P probably damaging Het
Camkmt C T 17: 85,096,581 T77I probably benign Het
Camsap1 G T 2: 25,935,550 Q1375K probably benign Het
Catsper2 G T 2: 121,397,123 probably null Het
Cd163 T C 6: 124,317,989 C671R probably damaging Het
Cdk7 T C 13: 100,717,684 probably null Het
Cfi C T 3: 129,873,077 P483L probably damaging Het
Chn2 C T 6: 54,218,561 L72F possibly damaging Het
Cntn2 C A 1: 132,517,060 E363* probably null Het
Crebbp T C 16: 4,093,511 E999G probably damaging Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Cts3 A C 13: 61,567,595 I141M probably benign Het
Cwc27 A T 13: 104,804,353 V166D probably damaging Het
Defb26 T C 2: 152,508,165 E65G possibly damaging Het
Dnah8 A G 17: 30,810,353 T4099A probably benign Het
Eml6 A G 11: 29,744,606 F1953L probably benign Het
Etl4 T A 2: 20,340,111 probably null Het
Fbln1 A G 15: 85,237,671 E331G probably damaging Het
Gabra4 G A 5: 71,572,203 H76Y probably benign Het
Gcat T C 15: 79,035,282 V149A probably damaging Het
Glp2r A T 11: 67,722,100 probably null Het
Gm572 T C 4: 148,666,845 probably null Het
Golgb1 T C 16: 36,919,258 V2653A probably damaging Het
Grap2 G A 15: 80,646,144 R155Q possibly damaging Het
Gspt1 T A 16: 11,223,301 I533L probably damaging Het
Gypa A T 8: 80,496,348 Y27F unknown Het
Hipk4 G A 7: 27,529,492 V456I probably benign Het
Homer2 A T 7: 81,649,563 D51E probably benign Het
Hspa1b A T 17: 34,958,004 V335E possibly damaging Het
Ift122 A G 6: 115,912,534 T827A probably benign Het
Igkv1-35 T C 6: 70,011,135 N58S probably benign Het
Kat6b A T 14: 21,619,258 H297L probably damaging Het
Kirrel3 G T 9: 35,013,305 G296W probably damaging Het
Klhl17 A G 4: 156,230,625 V525A probably benign Het
Lrrn1 G T 6: 107,569,207 R655S possibly damaging Het
Ltk T C 2: 119,753,227 N256D probably damaging Het
Mill2 G A 7: 18,856,666 G209S probably benign Het
Mmp27 A T 9: 7,581,368 H544L probably benign Het
Mphosph10 A G 7: 64,389,596 S209P probably damaging Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Myb T A 10: 21,126,238 M616L probably benign Het
Myo15b C T 11: 115,886,054 R867W probably damaging Het
Myo18b A T 5: 112,874,480 probably benign Het
Nip7 A G 8: 107,056,957 E8G possibly damaging Het
Olfr1318 A T 2: 112,156,286 M112L possibly damaging Het
Olfr368 T G 2: 37,332,589 F281V probably damaging Het
Olfr38 T A 6: 42,762,997 L315* probably null Het
Olfr677 A G 7: 105,056,482 T79A possibly damaging Het
Olfr711 T C 7: 106,972,231 I38V probably benign Het
Optn T A 2: 5,046,106 I155F probably benign Het
Papolb A T 5: 142,528,837 H350Q probably benign Het
Pappa2 T A 1: 158,838,627 M1128L probably benign Het
Pcdhb5 T A 18: 37,321,117 N183K probably benign Het
Pde12 G T 14: 26,669,422 S44* probably null Het
Pkd1 C T 17: 24,573,463 R1375C probably benign Het
Plekha5 G A 6: 140,579,474 E21K probably damaging Het
Plk2 C T 13: 110,399,424 P554L probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Polg A T 7: 79,464,605 W203R probably damaging Het
Ppcdc A G 9: 57,421,163 V65A possibly damaging Het
Ppm1m T A 9: 106,195,805 Q353L probably benign Het
Ppp1r13l G C 7: 19,370,095 R167P probably damaging Het
Ppp1r9b T A 11: 94,996,653 V497E probably damaging Het
Prpf6 T A 2: 181,636,043 H399Q probably benign Het
Psg25 T A 7: 18,526,536 I146F possibly damaging Het
Rasgef1c A T 11: 49,960,429 Q116L probably damaging Het
Rbbp9 A G 2: 144,550,756 V8A possibly damaging Het
Rfk T C 19: 17,399,566 F144S probably damaging Het
Rfwd3 A C 8: 111,282,753 probably null Het
Rhpn1 T C 15: 75,709,260 I117T probably damaging Het
Sars2 A T 7: 28,747,908 N244Y probably damaging Het
Scnn1b A T 7: 121,902,887 H256L probably benign Het
Sgcz G A 8: 37,539,667 T195I probably damaging Het
Sh3gl2 T A 4: 85,379,257 H157Q probably benign Het
Spen T A 4: 141,476,099 Q1739L probably benign Het
Susd1 G T 4: 59,379,657 S323R possibly damaging Het
Szt2 T C 4: 118,385,444 E1482G possibly damaging Het
Tex15 A T 8: 33,571,766 K408I probably damaging Het
Tex33 C T 15: 78,386,173 E132K probably benign Het
Trem1 T A 17: 48,232,836 F14L probably null Het
Trim26 G T 17: 36,851,066 E126* probably null Het
Trpv3 T C 11: 73,277,834 probably null Het
Ttn T A 2: 76,916,491 probably null Het
Ubap1 C T 4: 41,379,688 L301F probably benign Het
Uchl1 T C 5: 66,676,437 M12T probably benign Het
Vill C T 9: 119,070,025 T253I possibly damaging Het
Vmn2r107 C T 17: 20,355,753 T115I probably benign Het
Vmn2r98 T C 17: 19,053,553 S21P probably benign Het
Wapl A G 14: 34,677,162 K63E probably benign Het
Wnt2 T C 6: 18,023,126 K175E possibly damaging Het
Zfp592 T C 7: 81,023,561 L91P probably damaging Het
Zfp74 T C 7: 29,932,507 probably null Het
Zglp1 A T 9: 21,062,661 I243N probably benign Het
Zranb1 A G 7: 132,950,187 E215G probably benign Het
Other mutations in Peg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Peg3 APN 7 6710274 missense probably benign 0.09
IGL01410:Peg3 APN 7 6707625 missense probably benign 0.04
IGL01415:Peg3 APN 7 6711653 missense probably damaging 0.99
IGL02073:Peg3 APN 7 6711002 missense probably damaging 1.00
IGL02193:Peg3 APN 7 6711928 missense probably damaging 1.00
IGL02212:Peg3 APN 7 6711416 missense probably benign 0.41
IGL02215:Peg3 APN 7 6709011 missense probably benign 0.00
IGL02407:Peg3 APN 7 6707636 missense probably damaging 0.99
IGL02586:Peg3 APN 7 6710069 missense probably benign
IGL02673:Peg3 APN 7 6710414 missense probably damaging 1.00
IGL02935:Peg3 APN 7 6711129 missense probably damaging 1.00
IGL03277:Peg3 APN 7 6711674 missense probably damaging 1.00
IGL03330:Peg3 APN 7 6710413 missense probably damaging 1.00
IGL03393:Peg3 APN 7 6707649 missense probably damaging 0.99
R0049:Peg3 UTSW 7 6711673 missense possibly damaging 0.85
R0049:Peg3 UTSW 7 6711673 missense possibly damaging 0.85
R0518:Peg3 UTSW 7 6711428 missense probably damaging 1.00
R0521:Peg3 UTSW 7 6711428 missense probably damaging 1.00
R1477:Peg3 UTSW 7 6716142 missense probably damaging 1.00
R1716:Peg3 UTSW 7 6707781 missense possibly damaging 0.93
R1721:Peg3 UTSW 7 6709901 missense possibly damaging 0.92
R1732:Peg3 UTSW 7 6709085 missense possibly damaging 0.72
R2051:Peg3 UTSW 7 6712721 missense probably damaging 0.96
R2288:Peg3 UTSW 7 6709115 missense probably damaging 0.96
R3606:Peg3 UTSW 7 6708509 missense probably damaging 1.00
R5075:Peg3 UTSW 7 6708420 missense probably damaging 1.00
R5076:Peg3 UTSW 7 6708420 missense probably damaging 1.00
R5084:Peg3 UTSW 7 6707849 missense probably damaging 1.00
R5097:Peg3 UTSW 7 6710027 missense probably damaging 0.99
R5141:Peg3 UTSW 7 6709382 missense probably benign 0.03
R5292:Peg3 UTSW 7 6708260 missense probably damaging 1.00
R5294:Peg3 UTSW 7 6717849 missense possibly damaging 0.88
R5342:Peg3 UTSW 7 6709970 missense probably damaging 1.00
R5415:Peg3 UTSW 7 6708629 missense probably benign
R5906:Peg3 UTSW 7 6717855 missense probably damaging 0.99
R6056:Peg3 UTSW 7 6709571 missense probably damaging 1.00
R6259:Peg3 UTSW 7 6709811 missense probably damaging 0.99
R6529:Peg3 UTSW 7 6708072 missense probably damaging 1.00
R6631:Peg3 UTSW 7 6709070 missense possibly damaging 0.72
R6855:Peg3 UTSW 7 6708798 missense probably benign 0.13
R6861:Peg3 UTSW 7 6711386 nonsense probably null
R6864:Peg3 UTSW 7 6712762 missense probably damaging 1.00
R6892:Peg3 UTSW 7 6708899 missense possibly damaging 0.58
R7018:Peg3 UTSW 7 6708839 missense possibly damaging 0.72
R7039:Peg3 UTSW 7 6717859 missense probably damaging 0.99
R7066:Peg3 UTSW 7 6708857 missense probably damaging 1.00
R7117:Peg3 UTSW 7 6709168 unclassified probably benign
R7133:Peg3 UTSW 7 6708945 missense probably damaging 1.00
R7493:Peg3 UTSW 7 6709724 missense probably damaging 1.00
R7539:Peg3 UTSW 7 6708168 missense probably benign 0.00
R7642:Peg3 UTSW 7 6709168 unclassified probably benign
R7646:Peg3 UTSW 7 6709222 missense probably benign
R7658:Peg3 UTSW 7 6709610 missense probably damaging 1.00
R7846:Peg3 UTSW 7 6710651 missense probably damaging 1.00
R7853:Peg3 UTSW 7 6708840 missense possibly damaging 0.72
R7903:Peg3 UTSW 7 6709168 unclassified probably benign
R7913:Peg3 UTSW 7 6709168 unclassified probably benign
R7948:Peg3 UTSW 7 6708782 missense probably damaging 1.00
R8219:Peg3 UTSW 7 6708365 missense probably benign 0.00
R8385:Peg3 UTSW 7 6708083 missense probably damaging 1.00
R8672:Peg3 UTSW 7 6708524 missense possibly damaging 0.62
R9133:Peg3 UTSW 7 6709168 unclassified probably benign
R9209:Peg3 UTSW 7 6708227 missense possibly damaging 0.48
R9457:Peg3 UTSW 7 6707999 missense probably damaging 0.99
R9518:Peg3 UTSW 7 6711281 missense probably benign 0.00
R9519:Peg3 UTSW 7 6711395 missense probably benign 0.00
R9599:Peg3 UTSW 7 6711724 missense probably damaging 0.97
RF039:Peg3 UTSW 7 6709168 unclassified probably benign
YA93:Peg3 UTSW 7 6711647 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCATAGGTGTTGCCTCCAGAG -3'
(R):5'- AACAATGCCAGGGATGCAC -3'

Sequencing Primer
(F):5'- GTTGCCTCCAGAGTGTGCTC -3'
(R):5'- TGCACTGATGGGAAACTCAGACTC -3'
Posted On 2016-06-15