Incidental Mutation 'R5121:Sars2'
ID393021
Institutional Source Beutler Lab
Gene Symbol Sars2
Ensembl Gene ENSMUSG00000070699
Gene Nameseryl-aminoacyl-tRNA synthetase 2
Synonyms2410015F05Rik, D7Ertd353e
MMRRC Submission 042709-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #R5121 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28741992-28753871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28747908 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 244 (N244Y)
Ref Sequence ENSEMBL: ENSMUSP00000092216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094632] [ENSMUST00000207877]
Predicted Effect probably damaging
Transcript: ENSMUST00000094632
AA Change: N244Y

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092216
Gene: ENSMUSG00000070699
AA Change: N244Y

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 58 174 3.8e-8 PFAM
Pfam:tRNA-synt_2b 284 468 5.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207897
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mitochondrial seryl-tRNA synthethase precursor, a member of the class II tRNA synthetase family. The mature enzyme catalyzes the ligation of Serine to tRNA(Ser) and participates in the biosynthesis of selenocysteinyl-tRNA(sec) in mitochondria. The enzyme contains an N-terminal tRNA binding domain and a core catalytic domain. It functions in a homodimeric form, which is stabilized by tRNA binding. This gene is regulated by a bidirectional promoter that also controls the expression of mitochondrial ribosomal protein S12. Both genes are within the critical interval for the autosomal dominant deafness locus DFNA4 and might be linked to this disease. Multiple transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c A G 2: 58,281,650 I234T probably damaging Het
Adam24 A G 8: 40,679,511 E6G probably damaging Het
Amz1 A G 5: 140,744,164 D151G probably benign Het
Arhgap24 T C 5: 102,841,335 L10P probably damaging Het
Arhgap25 T G 6: 87,532,864 N8T probably benign Het
Arsi T G 18: 60,917,439 F465V probably damaging Het
Atp2c1 A G 9: 105,448,825 V293A probably damaging Het
Bzw2 A G 12: 36,104,351 L340P probably damaging Het
Camkmt C T 17: 85,096,581 T77I probably benign Het
Camsap1 G T 2: 25,935,550 Q1375K probably benign Het
Catsper2 G T 2: 121,397,123 probably null Het
Cd163 T C 6: 124,317,989 C671R probably damaging Het
Cdk7 T C 13: 100,717,684 probably null Het
Cfi C T 3: 129,873,077 P483L probably damaging Het
Chn2 C T 6: 54,218,561 L72F possibly damaging Het
Cntn2 C A 1: 132,517,060 E363* probably null Het
Crebbp T C 16: 4,093,511 E999G probably damaging Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Cts3 A C 13: 61,567,595 I141M probably benign Het
Cwc27 A T 13: 104,804,353 V166D probably damaging Het
Defb26 T C 2: 152,508,165 E65G possibly damaging Het
Dnah8 A G 17: 30,810,353 T4099A probably benign Het
Eml6 A G 11: 29,744,606 F1953L probably benign Het
Etl4 T A 2: 20,340,111 probably null Het
Fbln1 A G 15: 85,237,671 E331G probably damaging Het
Gabra4 G A 5: 71,572,203 H76Y probably benign Het
Gcat T C 15: 79,035,282 V149A probably damaging Het
Glp2r A T 11: 67,722,100 probably null Het
Gm572 T C 4: 148,666,845 probably null Het
Golgb1 T C 16: 36,919,258 V2653A probably damaging Het
Grap2 G A 15: 80,646,144 R155Q possibly damaging Het
Gspt1 T A 16: 11,223,301 I533L probably damaging Het
Gypa A T 8: 80,496,348 Y27F unknown Het
Hipk4 G A 7: 27,529,492 V456I probably benign Het
Homer2 A T 7: 81,649,563 D51E probably benign Het
Hspa1b A T 17: 34,958,004 V335E possibly damaging Het
Ift122 A G 6: 115,912,534 T827A probably benign Het
Igkv1-35 T C 6: 70,011,135 N58S probably benign Het
Kat6b A T 14: 21,619,258 H297L probably damaging Het
Kirrel3 G T 9: 35,013,305 G296W probably damaging Het
Klhl17 A G 4: 156,230,625 V525A probably benign Het
Lrrn1 G T 6: 107,569,207 R655S possibly damaging Het
Ltk T C 2: 119,753,227 N256D probably damaging Het
Mill2 G A 7: 18,856,666 G209S probably benign Het
Mmp27 A T 9: 7,581,368 H544L probably benign Het
Mphosph10 A G 7: 64,389,596 S209P probably damaging Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Myb T A 10: 21,126,238 M616L probably benign Het
Myo15b C T 11: 115,886,054 R867W probably damaging Het
Myo18b A T 5: 112,874,480 probably benign Het
Nip7 A G 8: 107,056,957 E8G possibly damaging Het
Olfr1318 A T 2: 112,156,286 M112L possibly damaging Het
Olfr368 T G 2: 37,332,589 F281V probably damaging Het
Olfr38 T A 6: 42,762,997 L315* probably null Het
Olfr677 A G 7: 105,056,482 T79A possibly damaging Het
Olfr711 T C 7: 106,972,231 I38V probably benign Het
Optn T A 2: 5,046,106 I155F probably benign Het
Papolb A T 5: 142,528,837 H350Q probably benign Het
Pappa2 T A 1: 158,838,627 M1128L probably benign Het
Pcdhb5 T A 18: 37,321,117 N183K probably benign Het
Pde12 G T 14: 26,669,422 S44* probably null Het
Peg3 T C 7: 6,710,289 K645E probably benign Het
Pkd1 C T 17: 24,573,463 R1375C probably benign Het
Plekha5 G A 6: 140,579,474 E21K probably damaging Het
Plk2 C T 13: 110,399,424 P554L probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Polg A T 7: 79,464,605 W203R probably damaging Het
Ppcdc A G 9: 57,421,163 V65A possibly damaging Het
Ppm1m T A 9: 106,195,805 Q353L probably benign Het
Ppp1r13l G C 7: 19,370,095 R167P probably damaging Het
Ppp1r9b T A 11: 94,996,653 V497E probably damaging Het
Prpf6 T A 2: 181,636,043 H399Q probably benign Het
Psg25 T A 7: 18,526,536 I146F possibly damaging Het
Rasgef1c A T 11: 49,960,429 Q116L probably damaging Het
Rbbp9 A G 2: 144,550,756 V8A possibly damaging Het
Rfk T C 19: 17,399,566 F144S probably damaging Het
Rfwd3 A C 8: 111,282,753 probably null Het
Rhpn1 T C 15: 75,709,260 I117T probably damaging Het
Scnn1b A T 7: 121,902,887 H256L probably benign Het
Sgcz G A 8: 37,539,667 T195I probably damaging Het
Sh3gl2 T A 4: 85,379,257 H157Q probably benign Het
Spen T A 4: 141,476,099 Q1739L probably benign Het
Susd1 G T 4: 59,379,657 S323R possibly damaging Het
Szt2 T C 4: 118,385,444 E1482G possibly damaging Het
Tex15 A T 8: 33,571,766 K408I probably damaging Het
Tex33 C T 15: 78,386,173 E132K probably benign Het
Trem1 T A 17: 48,232,836 F14L probably null Het
Trim26 G T 17: 36,851,066 E126* probably null Het
Trpv3 T C 11: 73,277,834 probably null Het
Ttn T A 2: 76,916,491 probably null Het
Ubap1 C T 4: 41,379,688 L301F probably benign Het
Uchl1 T C 5: 66,676,437 M12T probably benign Het
Vill C T 9: 119,070,025 T253I possibly damaging Het
Vmn2r107 C T 17: 20,355,753 T115I probably benign Het
Vmn2r98 T C 17: 19,053,553 S21P probably benign Het
Wapl A G 14: 34,677,162 K63E probably benign Het
Wnt2 T C 6: 18,023,126 K175E possibly damaging Het
Zfp592 T C 7: 81,023,561 L91P probably damaging Het
Zfp74 T C 7: 29,932,507 probably null Het
Zglp1 A T 9: 21,062,661 I243N probably benign Het
Zranb1 A G 7: 132,950,187 E215G probably benign Het
Other mutations in Sars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Sars2 APN 7 28753423 unclassified probably benign
IGL01376:Sars2 APN 7 28749883 missense probably damaging 1.00
IGL01633:Sars2 APN 7 28747549 missense probably benign 0.02
IGL02121:Sars2 APN 7 28752525 unclassified probably benign
IGL02488:Sars2 APN 7 28742160 nonsense probably null
IGL03062:Sars2 APN 7 28746781 missense possibly damaging 0.89
R1601:Sars2 UTSW 7 28748971 missense probably benign 0.26
R1857:Sars2 UTSW 7 28750012 missense probably benign 0.00
R1859:Sars2 UTSW 7 28744312 missense probably damaging 0.99
R2193:Sars2 UTSW 7 28748997 missense probably damaging 0.96
R2204:Sars2 UTSW 7 28749674 missense possibly damaging 0.95
R4452:Sars2 UTSW 7 28750093 missense probably benign 0.08
R4514:Sars2 UTSW 7 28742284 critical splice donor site probably null
R4921:Sars2 UTSW 7 28752438 missense possibly damaging 0.81
R5434:Sars2 UTSW 7 28750291 missense probably null 1.00
R5849:Sars2 UTSW 7 28744258 missense possibly damaging 0.92
R6668:Sars2 UTSW 7 28747004 missense probably benign 0.01
R7123:Sars2 UTSW 7 28753441 missense probably benign 0.40
R7205:Sars2 UTSW 7 28744308 missense probably benign
R7677:Sars2 UTSW 7 28746751 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ATATTTAATGCCCGGCCCGC -3'
(R):5'- TAACATACGCCGATGCTGAGAC -3'

Sequencing Primer
(F):5'- GCCTGTCATCTGGGCCTC -3'
(R):5'- GAGACAGAGTTTTCCCATGTTGCC -3'
Posted On2016-06-15