Incidental Mutation 'R5121:Or52e4'
ID 393027
Institutional Source Beutler Lab
Gene Symbol Or52e4
Ensembl Gene ENSMUSG00000073914
Gene Name olfactory receptor family 52 subfamily E member 4
Synonyms Olfr677, GA_x6K02T2PBJ9-7685262-7686200, MOR32-11
MMRRC Submission 042709-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.178) question?
Stock # R5121 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 104705455-104706393 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104705689 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 79 (T79A)
Ref Sequence ENSEMBL: ENSMUSP00000149888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098161] [ENSMUST00000213204]
AlphaFold Q8VF06
Predicted Effect possibly damaging
Transcript: ENSMUST00000098161
AA Change: T79A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095764
Gene: ENSMUSG00000073914
AA Change: T79A

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 7.6e-120 PFAM
Pfam:7TM_GPCR_Srsx 37 308 4.8e-6 PFAM
Pfam:7tm_1 43 293 1.3e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209491
Predicted Effect possibly damaging
Transcript: ENSMUST00000213204
AA Change: T79A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.2461 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c A G 2: 58,171,662 (GRCm39) I234T probably damaging Het
Adam24 A G 8: 41,132,550 (GRCm39) E6G probably damaging Het
Amz1 A G 5: 140,729,919 (GRCm39) D151G probably benign Het
Arhgap24 T C 5: 102,989,201 (GRCm39) L10P probably damaging Het
Arhgap25 T G 6: 87,509,846 (GRCm39) N8T probably benign Het
Arsi T G 18: 61,050,511 (GRCm39) F465V probably damaging Het
Atp2c1 A G 9: 105,326,024 (GRCm39) V293A probably damaging Het
Bzw2 A G 12: 36,154,350 (GRCm39) L340P probably damaging Het
Camkmt C T 17: 85,404,009 (GRCm39) T77I probably benign Het
Camsap1 G T 2: 25,825,562 (GRCm39) Q1375K probably benign Het
Catsper2 G T 2: 121,227,604 (GRCm39) probably null Het
Cd163 T C 6: 124,294,948 (GRCm39) C671R probably damaging Het
Cdk7 T C 13: 100,854,192 (GRCm39) probably null Het
Cfi C T 3: 129,666,726 (GRCm39) P483L probably damaging Het
Chn2 C T 6: 54,195,546 (GRCm39) L72F possibly damaging Het
Cimip4 C T 15: 78,270,373 (GRCm39) E132K probably benign Het
Cntn2 C A 1: 132,444,798 (GRCm39) E363* probably null Het
Crebbp T C 16: 3,911,375 (GRCm39) E999G probably damaging Het
Cspp1 T A 1: 10,196,688 (GRCm39) N900K probably damaging Het
Cts3 A C 13: 61,715,409 (GRCm39) I141M probably benign Het
Cwc27 A T 13: 104,940,861 (GRCm39) V166D probably damaging Het
Defb26 T C 2: 152,350,085 (GRCm39) E65G possibly damaging Het
Dnah8 A G 17: 31,029,327 (GRCm39) T4099A probably benign Het
Eml6 A G 11: 29,694,606 (GRCm39) F1953L probably benign Het
Etl4 T A 2: 20,344,922 (GRCm39) probably null Het
Fbln1 A G 15: 85,121,872 (GRCm39) E331G probably damaging Het
Gabra4 G A 5: 71,729,546 (GRCm39) H76Y probably benign Het
Gcat T C 15: 78,919,482 (GRCm39) V149A probably damaging Het
Glp2r A T 11: 67,612,926 (GRCm39) probably null Het
Gm572 T C 4: 148,751,302 (GRCm39) probably null Het
Golgb1 T C 16: 36,739,620 (GRCm39) V2653A probably damaging Het
Grap2 G A 15: 80,530,345 (GRCm39) R155Q possibly damaging Het
Gspt1 T A 16: 11,041,165 (GRCm39) I533L probably damaging Het
Gypa A T 8: 81,222,977 (GRCm39) Y27F unknown Het
Hipk4 G A 7: 27,228,917 (GRCm39) V456I probably benign Het
Homer2 A T 7: 81,299,311 (GRCm39) D51E probably benign Het
Hspa1b A T 17: 35,176,980 (GRCm39) V335E possibly damaging Het
Ift122 A G 6: 115,889,495 (GRCm39) T827A probably benign Het
Igkv1-35 T C 6: 69,988,119 (GRCm39) N58S probably benign Het
Kat6b A T 14: 21,669,326 (GRCm39) H297L probably damaging Het
Kirrel3 G T 9: 34,924,601 (GRCm39) G296W probably damaging Het
Klhl17 A G 4: 156,315,082 (GRCm39) V525A probably benign Het
Lrrn1 G T 6: 107,546,168 (GRCm39) R655S possibly damaging Het
Ltk T C 2: 119,583,708 (GRCm39) N256D probably damaging Het
Mill2 G A 7: 18,590,591 (GRCm39) G209S probably benign Het
Mmp27 A T 9: 7,581,369 (GRCm39) H544L probably benign Het
Mphosph10 A G 7: 64,039,344 (GRCm39) S209P probably damaging Het
Mphosph8 A T 14: 56,914,003 (GRCm39) K415* probably null Het
Myb T A 10: 21,002,137 (GRCm39) M616L probably benign Het
Myo15b C T 11: 115,776,880 (GRCm39) R867W probably damaging Het
Myo18b A T 5: 113,022,346 (GRCm39) probably benign Het
Nip7 A G 8: 107,783,589 (GRCm39) E8G possibly damaging Het
Optn T A 2: 5,050,917 (GRCm39) I155F probably benign Het
Or2f1b T A 6: 42,739,931 (GRCm39) L315* probably null Het
Or4f62 A T 2: 111,986,631 (GRCm39) M112L possibly damaging Het
Or5c1 T G 2: 37,222,601 (GRCm39) F281V probably damaging Het
Or6b6 T C 7: 106,571,438 (GRCm39) I38V probably benign Het
Papolb A T 5: 142,514,592 (GRCm39) H350Q probably benign Het
Pappa2 T A 1: 158,666,197 (GRCm39) M1128L probably benign Het
Pcdhb5 T A 18: 37,454,170 (GRCm39) N183K probably benign Het
Pde12 G T 14: 26,390,577 (GRCm39) S44* probably null Het
Peg3 T C 7: 6,713,288 (GRCm39) K645E probably benign Het
Pkd1 C T 17: 24,792,437 (GRCm39) R1375C probably benign Het
Plekha5 G A 6: 140,525,200 (GRCm39) E21K probably damaging Het
Plk2 C T 13: 110,535,958 (GRCm39) P554L probably benign Het
Pnkp C T 7: 44,511,827 (GRCm39) S113L probably damaging Het
Polg A T 7: 79,114,353 (GRCm39) W203R probably damaging Het
Ppcdc A G 9: 57,328,446 (GRCm39) V65A possibly damaging Het
Ppm1m T A 9: 106,073,004 (GRCm39) Q353L probably benign Het
Ppp1r13l G C 7: 19,104,020 (GRCm39) R167P probably damaging Het
Ppp1r9b T A 11: 94,887,479 (GRCm39) V497E probably damaging Het
Prpf6 T A 2: 181,277,836 (GRCm39) H399Q probably benign Het
Psg25 T A 7: 18,260,461 (GRCm39) I146F possibly damaging Het
Rasgef1c A T 11: 49,851,256 (GRCm39) Q116L probably damaging Het
Rbbp9 A G 2: 144,392,676 (GRCm39) V8A possibly damaging Het
Rfk T C 19: 17,376,930 (GRCm39) F144S probably damaging Het
Rfwd3 A C 8: 112,009,385 (GRCm39) probably null Het
Rhpn1 T C 15: 75,581,109 (GRCm39) I117T probably damaging Het
Sars2 A T 7: 28,447,333 (GRCm39) N244Y probably damaging Het
Scnn1b A T 7: 121,502,110 (GRCm39) H256L probably benign Het
Sgcz G A 8: 38,006,821 (GRCm39) T195I probably damaging Het
Sh3gl2 T A 4: 85,297,494 (GRCm39) H157Q probably benign Het
Spen T A 4: 141,203,410 (GRCm39) Q1739L probably benign Het
Susd1 G T 4: 59,379,657 (GRCm39) S323R possibly damaging Het
Szt2 T C 4: 118,242,641 (GRCm39) E1482G possibly damaging Het
Tex15 A T 8: 34,061,794 (GRCm39) K408I probably damaging Het
Trem1 T A 17: 48,539,864 (GRCm39) F14L probably null Het
Trim26 G T 17: 37,161,958 (GRCm39) E126* probably null Het
Trpv3 T C 11: 73,168,660 (GRCm39) probably null Het
Ttn T A 2: 76,746,835 (GRCm39) probably null Het
Ubap1 C T 4: 41,379,688 (GRCm39) L301F probably benign Het
Uchl1 T C 5: 66,833,780 (GRCm39) M12T probably benign Het
Vill C T 9: 118,899,093 (GRCm39) T253I possibly damaging Het
Vmn2r107 C T 17: 20,576,015 (GRCm39) T115I probably benign Het
Vmn2r98 T C 17: 19,273,815 (GRCm39) S21P probably benign Het
Wapl A G 14: 34,399,119 (GRCm39) K63E probably benign Het
Wnt2 T C 6: 18,023,125 (GRCm39) K175E possibly damaging Het
Zfp592 T C 7: 80,673,309 (GRCm39) L91P probably damaging Het
Zfp74 T C 7: 29,631,932 (GRCm39) probably null Het
Zglp1 A T 9: 20,973,957 (GRCm39) I243N probably benign Het
Zranb1 A G 7: 132,551,916 (GRCm39) E215G probably benign Het
Other mutations in Or52e4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02111:Or52e4 APN 7 104,706,152 (GRCm39) missense probably benign 0.10
IGL02351:Or52e4 APN 7 104,706,182 (GRCm39) missense probably damaging 0.98
IGL02358:Or52e4 APN 7 104,706,182 (GRCm39) missense probably damaging 0.98
IGL02696:Or52e4 APN 7 104,705,569 (GRCm39) missense probably benign 0.39
R0089:Or52e4 UTSW 7 104,706,297 (GRCm39) nonsense probably null
R0963:Or52e4 UTSW 7 104,706,179 (GRCm39) missense probably damaging 0.98
R1157:Or52e4 UTSW 7 104,706,091 (GRCm39) missense probably benign 0.01
R1719:Or52e4 UTSW 7 104,706,001 (GRCm39) missense probably damaging 0.97
R1998:Or52e4 UTSW 7 104,706,112 (GRCm39) missense probably benign 0.05
R2039:Or52e4 UTSW 7 104,705,597 (GRCm39) missense possibly damaging 0.75
R2180:Or52e4 UTSW 7 104,706,092 (GRCm39) missense probably benign 0.18
R2568:Or52e4 UTSW 7 104,705,878 (GRCm39) missense probably benign 0.00
R4700:Or52e4 UTSW 7 104,705,483 (GRCm39) missense possibly damaging 0.81
R4701:Or52e4 UTSW 7 104,706,086 (GRCm39) missense probably damaging 1.00
R4803:Or52e4 UTSW 7 104,705,863 (GRCm39) missense probably benign 0.39
R4888:Or52e4 UTSW 7 104,705,689 (GRCm39) missense possibly damaging 0.95
R5190:Or52e4 UTSW 7 104,705,660 (GRCm39) missense probably damaging 0.96
R5593:Or52e4 UTSW 7 104,705,711 (GRCm39) missense probably damaging 1.00
R6831:Or52e4 UTSW 7 104,706,086 (GRCm39) missense possibly damaging 0.95
R6991:Or52e4 UTSW 7 104,705,771 (GRCm39) missense probably damaging 1.00
R7387:Or52e4 UTSW 7 104,706,297 (GRCm39) nonsense probably null
R7812:Or52e4 UTSW 7 104,705,894 (GRCm39) missense possibly damaging 0.59
R7984:Or52e4 UTSW 7 104,705,639 (GRCm39) missense probably damaging 0.98
R8199:Or52e4 UTSW 7 104,705,852 (GRCm39) missense probably damaging 0.99
R9532:Or52e4 UTSW 7 104,706,275 (GRCm39) missense probably damaging 1.00
R9563:Or52e4 UTSW 7 104,706,281 (GRCm39) missense possibly damaging 0.80
R9646:Or52e4 UTSW 7 104,706,374 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTGGTAGGGATTCCAGGATTGG -3'
(R):5'- CTGAGAGAAGAAGGCTGATGGTTT -3'

Sequencing Primer
(F):5'- CCCTTGTGGGAAACATCA -3'
(R):5'- AGAGAAGAAGGCTGATGGTTTTATTG -3'
Posted On 2016-06-15