Incidental Mutation 'R0445:Shc1'
ID39304
Institutional Source Beutler Lab
Gene Symbol Shc1
Ensembl Gene ENSMUSG00000042626
Gene Namesrc homology 2 domain-containing transforming protein C1
SynonymsShcA, p66shc, p66
MMRRC Submission 038646-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R0445 (G1)
Quality Score169
Status Validated
Chromosome3
Chromosomal Location89418443-89430027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 89426537 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 226 (A226S)
Ref Sequence ENSEMBL: ENSMUSP00000140336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039110] [ENSMUST00000060061] [ENSMUST00000094378] [ENSMUST00000107413] [ENSMUST00000107417] [ENSMUST00000125036] [ENSMUST00000128238] [ENSMUST00000137793] [ENSMUST00000154791] [ENSMUST00000191485]
Predicted Effect probably damaging
Transcript: ENSMUST00000039110
AA Change: A226S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035361
Gene: ENSMUSG00000042626
AA Change: A226S

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
SH2 372 451 1.71e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060061
SMART Domains Protein: ENSMUSP00000053672
Gene: ENSMUSG00000047824

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
Blast:SH2 52 78 1e-9 BLAST
low complexity region 115 163 N/A INTRINSIC
low complexity region 177 193 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 242 261 N/A INTRINSIC
low complexity region 288 302 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
PHD 328 382 3.3e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094378
AA Change: A336S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091940
Gene: ENSMUSG00000042626
AA Change: A336S

DomainStartEndE-ValueType
low complexity region 16 55 N/A INTRINSIC
low complexity region 85 98 N/A INTRINSIC
low complexity region 116 127 N/A INTRINSIC
PTB 157 321 2.15e-31 SMART
SH2 482 561 1.71e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107413
SMART Domains Protein: ENSMUSP00000103036
Gene: ENSMUSG00000047824

DomainStartEndE-ValueType
Blast:SH2 15 41 1e-9 BLAST
low complexity region 78 126 N/A INTRINSIC
low complexity region 140 156 N/A INTRINSIC
low complexity region 163 177 N/A INTRINSIC
low complexity region 205 224 N/A INTRINSIC
low complexity region 251 265 N/A INTRINSIC
low complexity region 272 287 N/A INTRINSIC
PHD 291 345 3.3e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107417
AA Change: A181S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103040
Gene: ENSMUSG00000042626
AA Change: A181S

DomainStartEndE-ValueType
PTB 2 166 2.15e-31 SMART
SH2 327 406 1.71e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125036
AA Change: A170S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115509
Gene: ENSMUSG00000042626
AA Change: A170S

DomainStartEndE-ValueType
PTB 1 155 1.5e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125830
Predicted Effect probably damaging
Transcript: ENSMUST00000128238
AA Change: A208S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119293
Gene: ENSMUSG00000042626
AA Change: A208S

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:PID 52 144 7.7e-19 PFAM
Pfam:PID 134 190 7.8e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136573
Predicted Effect probably damaging
Transcript: ENSMUST00000137793
AA Change: A226S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117190
Gene: ENSMUSG00000042626
AA Change: A226S

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146306
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153334
Predicted Effect probably benign
Transcript: ENSMUST00000154791
SMART Domains Protein: ENSMUSP00000123635
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:PID 52 100 5.7e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191485
AA Change: A226S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140336
Gene: ENSMUSG00000042626
AA Change: A226S

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
SH2 372 451 1.71e-26 SMART
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes three main isoforms that differ in activities and subcellular location. While all three are adapter proteins in signal transduction pathways, the longest (p66Shc) may be involved in regulating life span and the effects of reactive oxygen species. The other two isoforms, p52Shc and p46Shc, link activated receptor tyrosine kinases to the Ras pathway by recruitment of the GRB2/SOS complex. p66Shc is not involved in Ras activation. Unlike the other two isoforms, p46Shc is targeted to the mitochondrial matrix. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygotes with a targeted mutation of the exon encoding the CH2 region show an extended life span, reduced cellular sensitivity to oxidative stress and UV irradiation, and resistance to diet-induced atherogenesis. Homozygotes lacking all three isoformsdie around E11.5 with cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A C 17: 48,090,022 probably null Het
4932438A13Rik T C 3: 37,000,065 V3111A probably damaging Het
A2m C T 6: 121,657,955 T687I probably damaging Het
Acsbg1 A G 9: 54,615,895 S483P probably damaging Het
Adam22 T A 5: 8,180,591 probably benign Het
Aggf1 A G 13: 95,354,001 V595A possibly damaging Het
Aplf A T 6: 87,663,752 L71I probably damaging Het
Arid3c G T 4: 41,725,172 P292T probably benign Het
Brms1l T A 12: 55,861,406 Y213* probably null Het
C87436 T A 6: 86,449,850 S332T possibly damaging Het
Cad G A 5: 31,072,709 A1454T probably benign Het
Cdkn3 T C 14: 46,767,400 probably null Het
Cnot1 A G 8: 95,760,208 C624R probably damaging Het
Cntnap5c A T 17: 58,104,743 I541F probably benign Het
Cyhr1 T C 15: 76,648,257 H217R probably damaging Het
Dennd1b A G 1: 139,167,765 probably benign Het
Dscam A T 16: 96,772,503 I753N probably damaging Het
Eef2 C CN 10: 81,178,770 probably null Het
Epg5 T A 18: 78,014,184 V1826D possibly damaging Het
Epha8 T C 4: 136,932,400 Y755C probably damaging Het
Esco1 A T 18: 10,574,989 N694K probably damaging Het
Fermt3 T C 19: 7,003,299 H300R probably benign Het
Galnt5 C A 2: 57,998,950 F187L probably benign Het
Gm17067 A G 7: 42,708,622 I152T probably benign Het
Gnb3 T C 6: 124,837,255 D154G possibly damaging Het
Gpr155 G A 2: 73,370,144 probably benign Het
Hdac3 A G 18: 37,943,724 I240T probably damaging Het
Ifitm1 A T 7: 140,968,441 probably null Het
Kif1b A T 4: 149,188,009 L1455Q probably benign Het
Krt1 A C 15: 101,847,621 L388R probably damaging Het
Lrp1 T A 10: 127,590,636 K635* probably null Het
Map3k2 A G 18: 32,217,210 Y371C probably damaging Het
Mcu T C 10: 59,456,645 probably benign Het
Mkrn1 C T 6: 39,404,854 V167I probably benign Het
Mrpl9 T A 3: 94,444,891 probably benign Het
Naip2 T C 13: 100,161,887 Y547C possibly damaging Het
Nup88 G A 11: 70,947,729 T487I probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Obscn C T 11: 58,999,335 R7457H unknown Het
Olfr1383 T A 11: 49,523,957 V78E probably damaging Het
Olfr272 G A 4: 52,910,849 T315M probably benign Het
Paf1 T C 7: 28,395,688 S118P probably damaging Het
Parp4 T A 14: 56,602,748 probably null Het
Pcdh15 A T 10: 74,342,549 Y157F probably damaging Het
Pex10 G A 4: 155,069,074 probably null Het
Phrf1 C T 7: 141,247,331 probably benign Het
Polr3a G T 14: 24,454,921 D1090E probably benign Het
Ppfia4 A C 1: 134,327,289 L276R probably benign Het
Rdh16f1 T C 10: 127,790,867 L263S probably benign Het
Ryr3 T C 2: 112,866,054 D967G probably benign Het
Slc4a1 A G 11: 102,354,366 V585A probably benign Het
Stk38l T A 6: 146,775,686 S461T probably benign Het
Tbkbp1 A T 11: 97,149,469 S40T probably damaging Het
Tet1 A G 10: 62,879,941 M25T probably benign Het
Themis A G 10: 28,782,011 R192G probably damaging Het
Tmem144 T C 3: 79,825,354 T206A probably benign Het
Tmem74b G A 2: 151,706,959 R202H probably damaging Het
Trpm1 T C 7: 64,244,842 probably benign Het
Vars A G 17: 35,011,809 H557R probably benign Het
Zbtb12 C A 17: 34,896,301 A354E possibly damaging Het
Zfp143 A T 7: 110,061,117 probably benign Het
Other mutations in Shc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Shc1 APN 3 89424229 missense probably damaging 0.99
IGL01608:Shc1 APN 3 89424849 missense probably damaging 0.96
IGL02710:Shc1 APN 3 89424610 splice site probably null
PIT4382001:Shc1 UTSW 3 89427408 missense probably benign 0.00
R0323:Shc1 UTSW 3 89423713 missense probably damaging 0.98
R0827:Shc1 UTSW 3 89426783 splice site probably null
R0833:Shc1 UTSW 3 89422969 missense probably damaging 1.00
R0836:Shc1 UTSW 3 89422969 missense probably damaging 1.00
R1155:Shc1 UTSW 3 89424819 missense probably benign 0.30
R1497:Shc1 UTSW 3 89428445 makesense probably null
R1929:Shc1 UTSW 3 89423542 missense probably damaging 1.00
R2271:Shc1 UTSW 3 89423542 missense probably damaging 1.00
R4402:Shc1 UTSW 3 89426678 missense probably benign
R4965:Shc1 UTSW 3 89426996 missense probably damaging 0.98
R5898:Shc1 UTSW 3 89426967 nonsense probably null
R6198:Shc1 UTSW 3 89422107 missense probably benign
R6604:Shc1 UTSW 3 89421879 missense probably damaging 1.00
R6673:Shc1 UTSW 3 89421962 missense possibly damaging 0.93
R6705:Shc1 UTSW 3 89422959 nonsense probably null
R7379:Shc1 UTSW 3 89426822 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCCCTTTGTGAAATCCTTCTGGAC -3'
(R):5'- TCCTTACCAGTGTAGCTCCCAAGTG -3'

Sequencing Primer
(F):5'- atctgcctgcctttgcc -3'
(R):5'- TCCCAAGTGGCTGGACATC -3'
Posted On2013-05-23