Incidental Mutation 'R5121:Zglp1'
ID 393040
Institutional Source Beutler Lab
Gene Symbol Zglp1
Ensembl Gene ENSMUSG00000079681
Gene Name zinc finger, GATA-like protein 1
Synonyms Glp1
MMRRC Submission 042709-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.367) question?
Stock # R5121 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 20973689-20978389 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20973957 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 243 (I243N)
Ref Sequence ENSEMBL: ENSMUSP00000111157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010348] [ENSMUST00000115494] [ENSMUST00000213826] [ENSMUST00000217359]
AlphaFold Q1WG82
Predicted Effect probably benign
Transcript: ENSMUST00000010348
SMART Domains Protein: ENSMUSP00000010348
Gene: ENSMUSG00000079677

DomainStartEndE-ValueType
Pfam:Fer2 64 147 5.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115494
AA Change: I243N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000111157
Gene: ENSMUSG00000079681
AA Change: I243N

DomainStartEndE-ValueType
Pfam:GATA 197 231 7.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217150
Predicted Effect probably benign
Transcript: ENSMUST00000217282
Predicted Effect probably benign
Transcript: ENSMUST00000217359
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations result in female and male infertility due to failure of germ cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c A G 2: 58,171,662 (GRCm39) I234T probably damaging Het
Adam24 A G 8: 41,132,550 (GRCm39) E6G probably damaging Het
Amz1 A G 5: 140,729,919 (GRCm39) D151G probably benign Het
Arhgap24 T C 5: 102,989,201 (GRCm39) L10P probably damaging Het
Arhgap25 T G 6: 87,509,846 (GRCm39) N8T probably benign Het
Arsi T G 18: 61,050,511 (GRCm39) F465V probably damaging Het
Atp2c1 A G 9: 105,326,024 (GRCm39) V293A probably damaging Het
Bzw2 A G 12: 36,154,350 (GRCm39) L340P probably damaging Het
Camkmt C T 17: 85,404,009 (GRCm39) T77I probably benign Het
Camsap1 G T 2: 25,825,562 (GRCm39) Q1375K probably benign Het
Catsper2 G T 2: 121,227,604 (GRCm39) probably null Het
Cd163 T C 6: 124,294,948 (GRCm39) C671R probably damaging Het
Cdk7 T C 13: 100,854,192 (GRCm39) probably null Het
Cfi C T 3: 129,666,726 (GRCm39) P483L probably damaging Het
Chn2 C T 6: 54,195,546 (GRCm39) L72F possibly damaging Het
Cimip4 C T 15: 78,270,373 (GRCm39) E132K probably benign Het
Cntn2 C A 1: 132,444,798 (GRCm39) E363* probably null Het
Crebbp T C 16: 3,911,375 (GRCm39) E999G probably damaging Het
Cspp1 T A 1: 10,196,688 (GRCm39) N900K probably damaging Het
Cts3 A C 13: 61,715,409 (GRCm39) I141M probably benign Het
Cwc27 A T 13: 104,940,861 (GRCm39) V166D probably damaging Het
Defb26 T C 2: 152,350,085 (GRCm39) E65G possibly damaging Het
Dnah8 A G 17: 31,029,327 (GRCm39) T4099A probably benign Het
Eml6 A G 11: 29,694,606 (GRCm39) F1953L probably benign Het
Etl4 T A 2: 20,344,922 (GRCm39) probably null Het
Fbln1 A G 15: 85,121,872 (GRCm39) E331G probably damaging Het
Gabra4 G A 5: 71,729,546 (GRCm39) H76Y probably benign Het
Gcat T C 15: 78,919,482 (GRCm39) V149A probably damaging Het
Glp2r A T 11: 67,612,926 (GRCm39) probably null Het
Gm572 T C 4: 148,751,302 (GRCm39) probably null Het
Golgb1 T C 16: 36,739,620 (GRCm39) V2653A probably damaging Het
Grap2 G A 15: 80,530,345 (GRCm39) R155Q possibly damaging Het
Gspt1 T A 16: 11,041,165 (GRCm39) I533L probably damaging Het
Gypa A T 8: 81,222,977 (GRCm39) Y27F unknown Het
Hipk4 G A 7: 27,228,917 (GRCm39) V456I probably benign Het
Homer2 A T 7: 81,299,311 (GRCm39) D51E probably benign Het
Hspa1b A T 17: 35,176,980 (GRCm39) V335E possibly damaging Het
Ift122 A G 6: 115,889,495 (GRCm39) T827A probably benign Het
Igkv1-35 T C 6: 69,988,119 (GRCm39) N58S probably benign Het
Kat6b A T 14: 21,669,326 (GRCm39) H297L probably damaging Het
Kirrel3 G T 9: 34,924,601 (GRCm39) G296W probably damaging Het
Klhl17 A G 4: 156,315,082 (GRCm39) V525A probably benign Het
Lrrn1 G T 6: 107,546,168 (GRCm39) R655S possibly damaging Het
Ltk T C 2: 119,583,708 (GRCm39) N256D probably damaging Het
Mill2 G A 7: 18,590,591 (GRCm39) G209S probably benign Het
Mmp27 A T 9: 7,581,369 (GRCm39) H544L probably benign Het
Mphosph10 A G 7: 64,039,344 (GRCm39) S209P probably damaging Het
Mphosph8 A T 14: 56,914,003 (GRCm39) K415* probably null Het
Myb T A 10: 21,002,137 (GRCm39) M616L probably benign Het
Myo15b C T 11: 115,776,880 (GRCm39) R867W probably damaging Het
Myo18b A T 5: 113,022,346 (GRCm39) probably benign Het
Nip7 A G 8: 107,783,589 (GRCm39) E8G possibly damaging Het
Optn T A 2: 5,050,917 (GRCm39) I155F probably benign Het
Or2f1b T A 6: 42,739,931 (GRCm39) L315* probably null Het
Or4f62 A T 2: 111,986,631 (GRCm39) M112L possibly damaging Het
Or52e4 A G 7: 104,705,689 (GRCm39) T79A possibly damaging Het
Or5c1 T G 2: 37,222,601 (GRCm39) F281V probably damaging Het
Or6b6 T C 7: 106,571,438 (GRCm39) I38V probably benign Het
Papolb A T 5: 142,514,592 (GRCm39) H350Q probably benign Het
Pappa2 T A 1: 158,666,197 (GRCm39) M1128L probably benign Het
Pcdhb5 T A 18: 37,454,170 (GRCm39) N183K probably benign Het
Pde12 G T 14: 26,390,577 (GRCm39) S44* probably null Het
Peg3 T C 7: 6,713,288 (GRCm39) K645E probably benign Het
Pkd1 C T 17: 24,792,437 (GRCm39) R1375C probably benign Het
Plekha5 G A 6: 140,525,200 (GRCm39) E21K probably damaging Het
Plk2 C T 13: 110,535,958 (GRCm39) P554L probably benign Het
Pnkp C T 7: 44,511,827 (GRCm39) S113L probably damaging Het
Polg A T 7: 79,114,353 (GRCm39) W203R probably damaging Het
Ppcdc A G 9: 57,328,446 (GRCm39) V65A possibly damaging Het
Ppm1m T A 9: 106,073,004 (GRCm39) Q353L probably benign Het
Ppp1r13l G C 7: 19,104,020 (GRCm39) R167P probably damaging Het
Ppp1r9b T A 11: 94,887,479 (GRCm39) V497E probably damaging Het
Prpf6 T A 2: 181,277,836 (GRCm39) H399Q probably benign Het
Psg25 T A 7: 18,260,461 (GRCm39) I146F possibly damaging Het
Rasgef1c A T 11: 49,851,256 (GRCm39) Q116L probably damaging Het
Rbbp9 A G 2: 144,392,676 (GRCm39) V8A possibly damaging Het
Rfk T C 19: 17,376,930 (GRCm39) F144S probably damaging Het
Rfwd3 A C 8: 112,009,385 (GRCm39) probably null Het
Rhpn1 T C 15: 75,581,109 (GRCm39) I117T probably damaging Het
Sars2 A T 7: 28,447,333 (GRCm39) N244Y probably damaging Het
Scnn1b A T 7: 121,502,110 (GRCm39) H256L probably benign Het
Sgcz G A 8: 38,006,821 (GRCm39) T195I probably damaging Het
Sh3gl2 T A 4: 85,297,494 (GRCm39) H157Q probably benign Het
Spen T A 4: 141,203,410 (GRCm39) Q1739L probably benign Het
Susd1 G T 4: 59,379,657 (GRCm39) S323R possibly damaging Het
Szt2 T C 4: 118,242,641 (GRCm39) E1482G possibly damaging Het
Tex15 A T 8: 34,061,794 (GRCm39) K408I probably damaging Het
Trem1 T A 17: 48,539,864 (GRCm39) F14L probably null Het
Trim26 G T 17: 37,161,958 (GRCm39) E126* probably null Het
Trpv3 T C 11: 73,168,660 (GRCm39) probably null Het
Ttn T A 2: 76,746,835 (GRCm39) probably null Het
Ubap1 C T 4: 41,379,688 (GRCm39) L301F probably benign Het
Uchl1 T C 5: 66,833,780 (GRCm39) M12T probably benign Het
Vill C T 9: 118,899,093 (GRCm39) T253I possibly damaging Het
Vmn2r107 C T 17: 20,576,015 (GRCm39) T115I probably benign Het
Vmn2r98 T C 17: 19,273,815 (GRCm39) S21P probably benign Het
Wapl A G 14: 34,399,119 (GRCm39) K63E probably benign Het
Wnt2 T C 6: 18,023,125 (GRCm39) K175E possibly damaging Het
Zfp592 T C 7: 80,673,309 (GRCm39) L91P probably damaging Het
Zfp74 T C 7: 29,631,932 (GRCm39) probably null Het
Zranb1 A G 7: 132,551,916 (GRCm39) E215G probably benign Het
Other mutations in Zglp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01718:Zglp1 APN 9 20,974,675 (GRCm39) missense probably benign 0.31
IGL02039:Zglp1 APN 9 20,978,335 (GRCm39) missense possibly damaging 0.95
IGL02682:Zglp1 APN 9 20,977,534 (GRCm39) missense probably benign 0.00
IGL03040:Zglp1 APN 9 20,974,622 (GRCm39) missense probably damaging 1.00
PIT4515001:Zglp1 UTSW 9 20,977,485 (GRCm39) missense probably benign 0.01
R0366:Zglp1 UTSW 9 20,974,675 (GRCm39) missense probably benign 0.31
R4174:Zglp1 UTSW 9 20,977,366 (GRCm39) missense possibly damaging 0.94
R4888:Zglp1 UTSW 9 20,973,957 (GRCm39) missense probably benign 0.00
R7103:Zglp1 UTSW 9 20,977,368 (GRCm39) missense probably benign 0.30
R7481:Zglp1 UTSW 9 20,973,903 (GRCm39) missense probably benign
R7581:Zglp1 UTSW 9 20,974,004 (GRCm39) missense probably damaging 1.00
R9109:Zglp1 UTSW 9 20,977,482 (GRCm39) missense probably benign 0.08
R9298:Zglp1 UTSW 9 20,977,482 (GRCm39) missense probably benign 0.08
Z1088:Zglp1 UTSW 9 20,978,296 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GGTTCATCCAGGACTGAGTG -3'
(R):5'- AGAGAAACAGCCACCTTGTG -3'

Sequencing Primer
(F):5'- ACAGGTGGGACTCTGGG -3'
(R):5'- GCCACCTTGTGAGGAAAATAGTTTC -3'
Posted On 2016-06-15