Incidental Mutation 'R5121:Kirrel3'
ID 393041
Institutional Source Beutler Lab
Gene Symbol Kirrel3
Ensembl Gene ENSMUSG00000032036
Gene Name kirre like nephrin family adhesion molecule 3
Synonyms 2900036G11Rik, Neph2, 1500010O20Rik
MMRRC Submission 042709-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock # R5121 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 34485894-35036716 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 35013305 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Tryptophan at position 296 (G296W)
Ref Sequence ENSEMBL: ENSMUSP00000110801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045091] [ENSMUST00000115148] [ENSMUST00000187182] [ENSMUST00000187625] [ENSMUST00000188658] [ENSMUST00000188933] [ENSMUST00000190549]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000045091
AA Change: G263W

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048863
Gene: ENSMUSG00000032036
AA Change: G263W

DomainStartEndE-ValueType
IG 21 111 1.35e-9 SMART
IG 122 214 2.56e-1 SMART
Pfam:Ig_2 217 298 2.1e-6 PFAM
IGc2 314 372 1.66e-9 SMART
IG 392 484 1.06e-2 SMART
transmembrane domain 491 513 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
low complexity region 700 717 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115148
AA Change: G296W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110801
Gene: ENSMUSG00000032036
AA Change: G296W

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 54 144 1.35e-9 SMART
IG 155 247 2.56e-1 SMART
Pfam:Ig_3 249 318 7.2e-6 PFAM
IGc2 347 405 1.66e-9 SMART
IG 425 517 1.06e-2 SMART
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 601 614 N/A INTRINSIC
low complexity region 733 750 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187182
AA Change: G270W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140219
Gene: ENSMUSG00000032036
AA Change: G270W

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 28 118 1.35e-9 SMART
IG 129 221 2.56e-1 SMART
Pfam:Ig_2 224 305 2.3e-6 PFAM
IGc2 321 379 1.66e-9 SMART
IG 399 491 1.06e-2 SMART
transmembrane domain 510 532 N/A INTRINSIC
low complexity region 612 625 N/A INTRINSIC
low complexity region 744 761 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187625
AA Change: G263W

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139951
Gene: ENSMUSG00000032036
AA Change: G263W

DomainStartEndE-ValueType
IG 21 111 1.35e-9 SMART
IG 122 214 2.56e-1 SMART
Pfam:Ig_2 217 298 2.1e-6 PFAM
IGc2 314 372 1.66e-9 SMART
IG 392 484 1.06e-2 SMART
transmembrane domain 491 513 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
low complexity region 700 717 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188658
SMART Domains Protein: ENSMUSP00000140086
Gene: ENSMUSG00000032036

DomainStartEndE-ValueType
Pfam:Ig_2 1 31 1.4e-1 PFAM
IG 40 132 4.5e-5 SMART
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188933
AA Change: G263W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139418
Gene: ENSMUSG00000032036
AA Change: G263W

DomainStartEndE-ValueType
IG 21 111 5.7e-12 SMART
IG 122 214 1.1e-3 SMART
Pfam:Ig_2 217 298 3.7e-5 PFAM
IGc2 314 372 6.8e-12 SMART
IG 392 484 4.5e-5 SMART
transmembrane domain 503 525 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 712 729 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190549
AA Change: G263W

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139714
Gene: ENSMUSG00000032036
AA Change: G263W

DomainStartEndE-ValueType
IG 21 111 5.7e-12 SMART
IG 122 214 1.1e-3 SMART
Pfam:Ig_2 217 298 2.6e-5 PFAM
IGc2 314 372 6.8e-12 SMART
IG 392 484 4.5e-5 SMART
transmembrane domain 491 513 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the nephrin-like protein family. These proteins are expressed in fetal and adult brain, and also in podocytes of kidney glomeruli. The cytoplasmic domains of these proteins interact with the C-terminus of podocin, also expressed in the podocytes, cells involved in ensuring size- and charge-selective ultrafiltration. Mutations in this gene are associated with mental retardation autosomal dominant type 4 (MRD4). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired accessory olfactory bulb formation with reduced coalescence of vomeronasal sensory neuron axons in the posterior accessory olfactory bulb, loss of male-male aggression and abnormal male sexual response to a male intruder mouse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c A G 2: 58,281,650 I234T probably damaging Het
Adam24 A G 8: 40,679,511 E6G probably damaging Het
Amz1 A G 5: 140,744,164 D151G probably benign Het
Arhgap24 T C 5: 102,841,335 L10P probably damaging Het
Arhgap25 T G 6: 87,532,864 N8T probably benign Het
Arsi T G 18: 60,917,439 F465V probably damaging Het
Atp2c1 A G 9: 105,448,825 V293A probably damaging Het
Bzw2 A G 12: 36,104,351 L340P probably damaging Het
Camkmt C T 17: 85,096,581 T77I probably benign Het
Camsap1 G T 2: 25,935,550 Q1375K probably benign Het
Catsper2 G T 2: 121,397,123 probably null Het
Cd163 T C 6: 124,317,989 C671R probably damaging Het
Cdk7 T C 13: 100,717,684 probably null Het
Cfi C T 3: 129,873,077 P483L probably damaging Het
Chn2 C T 6: 54,218,561 L72F possibly damaging Het
Cntn2 C A 1: 132,517,060 E363* probably null Het
Crebbp T C 16: 4,093,511 E999G probably damaging Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Cts3 A C 13: 61,567,595 I141M probably benign Het
Cwc27 A T 13: 104,804,353 V166D probably damaging Het
Defb26 T C 2: 152,508,165 E65G possibly damaging Het
Dnah8 A G 17: 30,810,353 T4099A probably benign Het
Eml6 A G 11: 29,744,606 F1953L probably benign Het
Etl4 T A 2: 20,340,111 probably null Het
Fbln1 A G 15: 85,237,671 E331G probably damaging Het
Gabra4 G A 5: 71,572,203 H76Y probably benign Het
Gcat T C 15: 79,035,282 V149A probably damaging Het
Glp2r A T 11: 67,722,100 probably null Het
Gm572 T C 4: 148,666,845 probably null Het
Golgb1 T C 16: 36,919,258 V2653A probably damaging Het
Grap2 G A 15: 80,646,144 R155Q possibly damaging Het
Gspt1 T A 16: 11,223,301 I533L probably damaging Het
Gypa A T 8: 80,496,348 Y27F unknown Het
Hipk4 G A 7: 27,529,492 V456I probably benign Het
Homer2 A T 7: 81,649,563 D51E probably benign Het
Hspa1b A T 17: 34,958,004 V335E possibly damaging Het
Ift122 A G 6: 115,912,534 T827A probably benign Het
Igkv1-35 T C 6: 70,011,135 N58S probably benign Het
Kat6b A T 14: 21,619,258 H297L probably damaging Het
Klhl17 A G 4: 156,230,625 V525A probably benign Het
Lrrn1 G T 6: 107,569,207 R655S possibly damaging Het
Ltk T C 2: 119,753,227 N256D probably damaging Het
Mill2 G A 7: 18,856,666 G209S probably benign Het
Mmp27 A T 9: 7,581,368 H544L probably benign Het
Mphosph10 A G 7: 64,389,596 S209P probably damaging Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Myb T A 10: 21,126,238 M616L probably benign Het
Myo15b C T 11: 115,886,054 R867W probably damaging Het
Myo18b A T 5: 112,874,480 probably benign Het
Nip7 A G 8: 107,056,957 E8G possibly damaging Het
Olfr1318 A T 2: 112,156,286 M112L possibly damaging Het
Olfr368 T G 2: 37,332,589 F281V probably damaging Het
Olfr38 T A 6: 42,762,997 L315* probably null Het
Olfr677 A G 7: 105,056,482 T79A possibly damaging Het
Olfr711 T C 7: 106,972,231 I38V probably benign Het
Optn T A 2: 5,046,106 I155F probably benign Het
Papolb A T 5: 142,528,837 H350Q probably benign Het
Pappa2 T A 1: 158,838,627 M1128L probably benign Het
Pcdhb5 T A 18: 37,321,117 N183K probably benign Het
Pde12 G T 14: 26,669,422 S44* probably null Het
Peg3 T C 7: 6,710,289 K645E probably benign Het
Pkd1 C T 17: 24,573,463 R1375C probably benign Het
Plekha5 G A 6: 140,579,474 E21K probably damaging Het
Plk2 C T 13: 110,399,424 P554L probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Polg A T 7: 79,464,605 W203R probably damaging Het
Ppcdc A G 9: 57,421,163 V65A possibly damaging Het
Ppm1m T A 9: 106,195,805 Q353L probably benign Het
Ppp1r13l G C 7: 19,370,095 R167P probably damaging Het
Ppp1r9b T A 11: 94,996,653 V497E probably damaging Het
Prpf6 T A 2: 181,636,043 H399Q probably benign Het
Psg25 T A 7: 18,526,536 I146F possibly damaging Het
Rasgef1c A T 11: 49,960,429 Q116L probably damaging Het
Rbbp9 A G 2: 144,550,756 V8A possibly damaging Het
Rfk T C 19: 17,399,566 F144S probably damaging Het
Rfwd3 A C 8: 111,282,753 probably null Het
Rhpn1 T C 15: 75,709,260 I117T probably damaging Het
Sars2 A T 7: 28,747,908 N244Y probably damaging Het
Scnn1b A T 7: 121,902,887 H256L probably benign Het
Sgcz G A 8: 37,539,667 T195I probably damaging Het
Sh3gl2 T A 4: 85,379,257 H157Q probably benign Het
Spen T A 4: 141,476,099 Q1739L probably benign Het
Susd1 G T 4: 59,379,657 S323R possibly damaging Het
Szt2 T C 4: 118,385,444 E1482G possibly damaging Het
Tex15 A T 8: 33,571,766 K408I probably damaging Het
Tex33 C T 15: 78,386,173 E132K probably benign Het
Trem1 T A 17: 48,232,836 F14L probably null Het
Trim26 G T 17: 36,851,066 E126* probably null Het
Trpv3 T C 11: 73,277,834 probably null Het
Ttn T A 2: 76,916,491 probably null Het
Ubap1 C T 4: 41,379,688 L301F probably benign Het
Uchl1 T C 5: 66,676,437 M12T probably benign Het
Vill C T 9: 119,070,025 T253I possibly damaging Het
Vmn2r107 C T 17: 20,355,753 T115I probably benign Het
Vmn2r98 T C 17: 19,053,553 S21P probably benign Het
Wapl A G 14: 34,677,162 K63E probably benign Het
Wnt2 T C 6: 18,023,126 K175E possibly damaging Het
Zfp592 T C 7: 81,023,561 L91P probably damaging Het
Zfp74 T C 7: 29,932,507 probably null Het
Zglp1 A T 9: 21,062,661 I243N probably benign Het
Zranb1 A G 7: 132,950,187 E215G probably benign Het
Other mutations in Kirrel3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Kirrel3 APN 9 35015253 critical splice acceptor site probably null
IGL01369:Kirrel3 APN 9 35016441 missense probably benign 0.07
IGL01837:Kirrel3 APN 9 35034928 missense probably damaging 1.00
IGL01950:Kirrel3 APN 9 35028329 splice site probably benign
IGL01973:Kirrel3 APN 9 35016468 missense probably damaging 1.00
IGL01994:Kirrel3 APN 9 35020133 missense possibly damaging 0.71
IGL03184:Kirrel3 APN 9 35007756 missense probably damaging 1.00
R0033:Kirrel3 UTSW 9 35000963 missense probably benign 0.06
R0033:Kirrel3 UTSW 9 35000963 missense probably benign 0.06
R0038:Kirrel3 UTSW 9 34911770 splice site probably null
R0038:Kirrel3 UTSW 9 34911770 splice site probably null
R0390:Kirrel3 UTSW 9 35020163 missense probably damaging 1.00
R0627:Kirrel3 UTSW 9 35035174 missense probably damaging 1.00
R0786:Kirrel3 UTSW 9 35034865 missense probably damaging 1.00
R0920:Kirrel3 UTSW 9 35028352 missense probably damaging 1.00
R0962:Kirrel3 UTSW 9 35000997 missense possibly damaging 0.95
R1716:Kirrel3 UTSW 9 35023547 missense probably damaging 1.00
R2010:Kirrel3 UTSW 9 34939198 missense probably damaging 1.00
R4289:Kirrel3 UTSW 9 35023473 missense probably benign 0.44
R4888:Kirrel3 UTSW 9 35013305 missense probably damaging 1.00
R4970:Kirrel3 UTSW 9 34944439 missense possibly damaging 0.88
R5368:Kirrel3 UTSW 9 35007738 missense probably damaging 1.00
R5572:Kirrel3 UTSW 9 35000948 missense probably damaging 1.00
R5707:Kirrel3 UTSW 9 35013276 missense probably damaging 1.00
R6302:Kirrel3 UTSW 9 35007749 missense probably damaging 1.00
R6449:Kirrel3 UTSW 9 34990973 missense probably benign
R6908:Kirrel3 UTSW 9 35013401 missense possibly damaging 0.86
R6967:Kirrel3 UTSW 9 35034906 missense probably damaging 1.00
R7578:Kirrel3 UTSW 9 34939112 missense probably damaging 1.00
R7861:Kirrel3 UTSW 9 35020123 missense possibly damaging 0.79
R8094:Kirrel3 UTSW 9 35035164 missense probably damaging 1.00
R8383:Kirrel3 UTSW 9 35029883 missense probably null 0.89
R8494:Kirrel3 UTSW 9 34991045 missense probably benign 0.03
R8878:Kirrel3 UTSW 9 34939265 splice site probably benign
R8955:Kirrel3 UTSW 9 34944442 missense probably damaging 1.00
R9140:Kirrel3 UTSW 9 35013300 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCTCGACCATGGCTCAAAG -3'
(R):5'- GGAGATGCTGTAACACGCAAC -3'

Sequencing Primer
(F):5'- GGCTCAAAGGCAATCACCTG -3'
(R):5'- GAGTCTAGCTATAGTCTCAGCCAC -3'
Posted On 2016-06-15