Incidental Mutation 'R5121:Eml6'
ID 393047
Institutional Source Beutler Lab
Gene Symbol Eml6
Ensembl Gene ENSMUSG00000044072
Gene Name echinoderm microtubule associated protein like 6
Synonyms 2900083P10Rik, C230094A16Rik
MMRRC Submission 042709-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.204) question?
Stock # R5121 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 29693048-29976033 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 29694606 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 1953 (F1953L)
Ref Sequence ENSEMBL: ENSMUSP00000051080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058902] [ENSMUST00000060992] [ENSMUST00000078830] [ENSMUST00000102841] [ENSMUST00000102842] [ENSMUST00000102843] [ENSMUST00000170731]
AlphaFold Q5SQM0
Predicted Effect probably benign
Transcript: ENSMUST00000058902
AA Change: F1953L

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072
AA Change: F1953L

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
WD40 49 91 1.79e-1 SMART
WD40 94 136 1.42e-4 SMART
WD40 139 178 5.31e-4 SMART
WD40 184 224 8.84e1 SMART
WD40 225 263 3.75e-4 SMART
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.22e0 SMART
WD40 397 436 1.72e0 SMART
WD40 505 546 1.7e2 SMART
WD40 552 592 4.55e-3 SMART
low complexity region 613 625 N/A INTRINSIC
Pfam:HELP 653 715 1.9e-22 PFAM
WD40 716 757 9.24e-1 SMART
WD40 760 802 6.53e-4 SMART
WD40 805 844 2.98e-1 SMART
WD40 856 891 8.52e1 SMART
WD40 892 929 2.09e-2 SMART
WD40 986 1026 1.18e-1 SMART
WD40 1032 1068 3.44e0 SMART
WD40 1071 1111 2.58e-1 SMART
WD40 1180 1221 9.24e-1 SMART
WD40 1227 1267 3.85e-1 SMART
low complexity region 1280 1291 N/A INTRINSIC
Pfam:HELP 1329 1402 5e-15 PFAM
WD40 1404 1447 2.66e0 SMART
WD40 1450 1492 1.85e0 SMART
WD40 1495 1534 2.97e0 SMART
WD40 1543 1582 7.1e1 SMART
WD40 1584 1629 9.51e1 SMART
WD40 1675 1715 3.05e-4 SMART
WD40 1718 1758 8.84e1 SMART
WD40 1759 1798 7.16e-1 SMART
WD40 1869 1910 1.53e1 SMART
WD40 1916 1956 4.62e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060992
SMART Domains Protein: ENSMUSP00000053754
Gene: ENSMUSG00000020458

DomainStartEndE-ValueType
Pfam:Reticulon 12 182 7.4e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078830
SMART Domains Protein: ENSMUSP00000077875
Gene: ENSMUSG00000020458

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
Pfam:Reticulon 169 339 4.2e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102841
SMART Domains Protein: ENSMUSP00000099905
Gene: ENSMUSG00000020458

DomainStartEndE-ValueType
low complexity region 102 110 N/A INTRINSIC
Pfam:Reticulon 859 1029 6.3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102842
SMART Domains Protein: ENSMUSP00000099906
Gene: ENSMUSG00000020458

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
Pfam:Reticulon 188 358 4.8e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102843
SMART Domains Protein: ENSMUSP00000099907
Gene: ENSMUSG00000020458

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
low complexity region 218 226 N/A INTRINSIC
Pfam:Reticulon 975 1139 2.4e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156217
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142651
Predicted Effect probably benign
Transcript: ENSMUST00000170731
SMART Domains Protein: ENSMUSP00000126413
Gene: ENSMUSG00000020458

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
Pfam:Reticulon 169 339 4.2e-58 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c A G 2: 58,171,662 (GRCm39) I234T probably damaging Het
Adam24 A G 8: 41,132,550 (GRCm39) E6G probably damaging Het
Amz1 A G 5: 140,729,919 (GRCm39) D151G probably benign Het
Arhgap24 T C 5: 102,989,201 (GRCm39) L10P probably damaging Het
Arhgap25 T G 6: 87,509,846 (GRCm39) N8T probably benign Het
Arsi T G 18: 61,050,511 (GRCm39) F465V probably damaging Het
Atp2c1 A G 9: 105,326,024 (GRCm39) V293A probably damaging Het
Bzw2 A G 12: 36,154,350 (GRCm39) L340P probably damaging Het
Camkmt C T 17: 85,404,009 (GRCm39) T77I probably benign Het
Camsap1 G T 2: 25,825,562 (GRCm39) Q1375K probably benign Het
Catsper2 G T 2: 121,227,604 (GRCm39) probably null Het
Cd163 T C 6: 124,294,948 (GRCm39) C671R probably damaging Het
Cdk7 T C 13: 100,854,192 (GRCm39) probably null Het
Cfi C T 3: 129,666,726 (GRCm39) P483L probably damaging Het
Chn2 C T 6: 54,195,546 (GRCm39) L72F possibly damaging Het
Cimip4 C T 15: 78,270,373 (GRCm39) E132K probably benign Het
Cntn2 C A 1: 132,444,798 (GRCm39) E363* probably null Het
Crebbp T C 16: 3,911,375 (GRCm39) E999G probably damaging Het
Cspp1 T A 1: 10,196,688 (GRCm39) N900K probably damaging Het
Cts3 A C 13: 61,715,409 (GRCm39) I141M probably benign Het
Cwc27 A T 13: 104,940,861 (GRCm39) V166D probably damaging Het
Defb26 T C 2: 152,350,085 (GRCm39) E65G possibly damaging Het
Dnah8 A G 17: 31,029,327 (GRCm39) T4099A probably benign Het
Etl4 T A 2: 20,344,922 (GRCm39) probably null Het
Fbln1 A G 15: 85,121,872 (GRCm39) E331G probably damaging Het
Gabra4 G A 5: 71,729,546 (GRCm39) H76Y probably benign Het
Gcat T C 15: 78,919,482 (GRCm39) V149A probably damaging Het
Glp2r A T 11: 67,612,926 (GRCm39) probably null Het
Gm572 T C 4: 148,751,302 (GRCm39) probably null Het
Golgb1 T C 16: 36,739,620 (GRCm39) V2653A probably damaging Het
Grap2 G A 15: 80,530,345 (GRCm39) R155Q possibly damaging Het
Gspt1 T A 16: 11,041,165 (GRCm39) I533L probably damaging Het
Gypa A T 8: 81,222,977 (GRCm39) Y27F unknown Het
Hipk4 G A 7: 27,228,917 (GRCm39) V456I probably benign Het
Homer2 A T 7: 81,299,311 (GRCm39) D51E probably benign Het
Hspa1b A T 17: 35,176,980 (GRCm39) V335E possibly damaging Het
Ift122 A G 6: 115,889,495 (GRCm39) T827A probably benign Het
Igkv1-35 T C 6: 69,988,119 (GRCm39) N58S probably benign Het
Kat6b A T 14: 21,669,326 (GRCm39) H297L probably damaging Het
Kirrel3 G T 9: 34,924,601 (GRCm39) G296W probably damaging Het
Klhl17 A G 4: 156,315,082 (GRCm39) V525A probably benign Het
Lrrn1 G T 6: 107,546,168 (GRCm39) R655S possibly damaging Het
Ltk T C 2: 119,583,708 (GRCm39) N256D probably damaging Het
Mill2 G A 7: 18,590,591 (GRCm39) G209S probably benign Het
Mmp27 A T 9: 7,581,369 (GRCm39) H544L probably benign Het
Mphosph10 A G 7: 64,039,344 (GRCm39) S209P probably damaging Het
Mphosph8 A T 14: 56,914,003 (GRCm39) K415* probably null Het
Myb T A 10: 21,002,137 (GRCm39) M616L probably benign Het
Myo15b C T 11: 115,776,880 (GRCm39) R867W probably damaging Het
Myo18b A T 5: 113,022,346 (GRCm39) probably benign Het
Nip7 A G 8: 107,783,589 (GRCm39) E8G possibly damaging Het
Optn T A 2: 5,050,917 (GRCm39) I155F probably benign Het
Or2f1b T A 6: 42,739,931 (GRCm39) L315* probably null Het
Or4f62 A T 2: 111,986,631 (GRCm39) M112L possibly damaging Het
Or52e4 A G 7: 104,705,689 (GRCm39) T79A possibly damaging Het
Or5c1 T G 2: 37,222,601 (GRCm39) F281V probably damaging Het
Or6b6 T C 7: 106,571,438 (GRCm39) I38V probably benign Het
Papolb A T 5: 142,514,592 (GRCm39) H350Q probably benign Het
Pappa2 T A 1: 158,666,197 (GRCm39) M1128L probably benign Het
Pcdhb5 T A 18: 37,454,170 (GRCm39) N183K probably benign Het
Pde12 G T 14: 26,390,577 (GRCm39) S44* probably null Het
Peg3 T C 7: 6,713,288 (GRCm39) K645E probably benign Het
Pkd1 C T 17: 24,792,437 (GRCm39) R1375C probably benign Het
Plekha5 G A 6: 140,525,200 (GRCm39) E21K probably damaging Het
Plk2 C T 13: 110,535,958 (GRCm39) P554L probably benign Het
Pnkp C T 7: 44,511,827 (GRCm39) S113L probably damaging Het
Polg A T 7: 79,114,353 (GRCm39) W203R probably damaging Het
Ppcdc A G 9: 57,328,446 (GRCm39) V65A possibly damaging Het
Ppm1m T A 9: 106,073,004 (GRCm39) Q353L probably benign Het
Ppp1r13l G C 7: 19,104,020 (GRCm39) R167P probably damaging Het
Ppp1r9b T A 11: 94,887,479 (GRCm39) V497E probably damaging Het
Prpf6 T A 2: 181,277,836 (GRCm39) H399Q probably benign Het
Psg25 T A 7: 18,260,461 (GRCm39) I146F possibly damaging Het
Rasgef1c A T 11: 49,851,256 (GRCm39) Q116L probably damaging Het
Rbbp9 A G 2: 144,392,676 (GRCm39) V8A possibly damaging Het
Rfk T C 19: 17,376,930 (GRCm39) F144S probably damaging Het
Rfwd3 A C 8: 112,009,385 (GRCm39) probably null Het
Rhpn1 T C 15: 75,581,109 (GRCm39) I117T probably damaging Het
Sars2 A T 7: 28,447,333 (GRCm39) N244Y probably damaging Het
Scnn1b A T 7: 121,502,110 (GRCm39) H256L probably benign Het
Sgcz G A 8: 38,006,821 (GRCm39) T195I probably damaging Het
Sh3gl2 T A 4: 85,297,494 (GRCm39) H157Q probably benign Het
Spen T A 4: 141,203,410 (GRCm39) Q1739L probably benign Het
Susd1 G T 4: 59,379,657 (GRCm39) S323R possibly damaging Het
Szt2 T C 4: 118,242,641 (GRCm39) E1482G possibly damaging Het
Tex15 A T 8: 34,061,794 (GRCm39) K408I probably damaging Het
Trem1 T A 17: 48,539,864 (GRCm39) F14L probably null Het
Trim26 G T 17: 37,161,958 (GRCm39) E126* probably null Het
Trpv3 T C 11: 73,168,660 (GRCm39) probably null Het
Ttn T A 2: 76,746,835 (GRCm39) probably null Het
Ubap1 C T 4: 41,379,688 (GRCm39) L301F probably benign Het
Uchl1 T C 5: 66,833,780 (GRCm39) M12T probably benign Het
Vill C T 9: 118,899,093 (GRCm39) T253I possibly damaging Het
Vmn2r107 C T 17: 20,576,015 (GRCm39) T115I probably benign Het
Vmn2r98 T C 17: 19,273,815 (GRCm39) S21P probably benign Het
Wapl A G 14: 34,399,119 (GRCm39) K63E probably benign Het
Wnt2 T C 6: 18,023,125 (GRCm39) K175E possibly damaging Het
Zfp592 T C 7: 80,673,309 (GRCm39) L91P probably damaging Het
Zfp74 T C 7: 29,631,932 (GRCm39) probably null Het
Zglp1 A T 9: 20,973,957 (GRCm39) I243N probably benign Het
Zranb1 A G 7: 132,551,916 (GRCm39) E215G probably benign Het
Other mutations in Eml6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Eml6 APN 11 29,800,816 (GRCm39) critical splice donor site probably null
IGL01407:Eml6 APN 11 29,705,021 (GRCm39) nonsense probably null
IGL01434:Eml6 APN 11 29,769,090 (GRCm39) missense probably damaging 1.00
IGL01578:Eml6 APN 11 29,800,870 (GRCm39) missense probably benign 0.02
IGL01780:Eml6 APN 11 29,755,175 (GRCm39) missense probably benign 0.17
IGL01821:Eml6 APN 11 29,771,699 (GRCm39) missense probably benign 0.00
IGL01837:Eml6 APN 11 29,727,055 (GRCm39) missense probably benign 0.00
IGL01904:Eml6 APN 11 29,788,613 (GRCm39) nonsense probably null
IGL01972:Eml6 APN 11 29,788,451 (GRCm39) missense possibly damaging 0.67
IGL02134:Eml6 APN 11 29,709,066 (GRCm39) missense probably benign 0.13
IGL02192:Eml6 APN 11 29,755,743 (GRCm39) missense probably benign 0.00
IGL02377:Eml6 APN 11 29,727,282 (GRCm39) missense probably damaging 0.98
IGL02584:Eml6 APN 11 29,699,387 (GRCm39) missense probably damaging 0.99
IGL02587:Eml6 APN 11 29,734,236 (GRCm39) missense possibly damaging 0.92
IGL02810:Eml6 APN 11 29,799,016 (GRCm39) missense possibly damaging 0.94
IGL02873:Eml6 APN 11 29,830,700 (GRCm39) missense probably benign 0.10
IGL02880:Eml6 APN 11 29,699,959 (GRCm39) missense probably benign 0.03
IGL03289:Eml6 APN 11 29,745,328 (GRCm39) missense possibly damaging 0.49
IGL03301:Eml6 APN 11 29,714,083 (GRCm39) missense probably benign 0.18
IGL03386:Eml6 APN 11 29,699,934 (GRCm39) missense probably benign
IGL03407:Eml6 APN 11 29,856,330 (GRCm39) missense probably damaging 1.00
PIT4453001:Eml6 UTSW 11 29,752,489 (GRCm39) missense probably damaging 1.00
R0125:Eml6 UTSW 11 29,832,088 (GRCm39) missense probably benign 0.19
R0240:Eml6 UTSW 11 29,742,367 (GRCm39) missense possibly damaging 0.84
R0240:Eml6 UTSW 11 29,742,367 (GRCm39) missense possibly damaging 0.84
R0271:Eml6 UTSW 11 29,798,949 (GRCm39) missense possibly damaging 0.48
R0304:Eml6 UTSW 11 29,727,441 (GRCm39) missense probably benign 0.00
R0415:Eml6 UTSW 11 29,699,392 (GRCm39) missense possibly damaging 0.84
R0449:Eml6 UTSW 11 29,843,213 (GRCm39) missense probably benign 0.01
R0538:Eml6 UTSW 11 29,710,010 (GRCm39) splice site probably benign
R0671:Eml6 UTSW 11 29,755,065 (GRCm39) missense probably benign 0.00
R0766:Eml6 UTSW 11 29,781,219 (GRCm39) splice site probably benign
R0800:Eml6 UTSW 11 29,699,877 (GRCm39) missense probably benign 0.08
R0841:Eml6 UTSW 11 29,727,430 (GRCm39) missense probably benign 0.41
R0879:Eml6 UTSW 11 29,800,816 (GRCm39) critical splice donor site probably null
R1061:Eml6 UTSW 11 29,727,267 (GRCm39) missense probably damaging 1.00
R1145:Eml6 UTSW 11 29,727,430 (GRCm39) missense probably benign 0.41
R1145:Eml6 UTSW 11 29,727,430 (GRCm39) missense probably benign 0.41
R1172:Eml6 UTSW 11 29,699,824 (GRCm39) missense possibly damaging 0.54
R1173:Eml6 UTSW 11 29,699,824 (GRCm39) missense possibly damaging 0.54
R1174:Eml6 UTSW 11 29,699,824 (GRCm39) missense possibly damaging 0.54
R1199:Eml6 UTSW 11 29,705,044 (GRCm39) missense possibly damaging 0.93
R1311:Eml6 UTSW 11 29,781,088 (GRCm39) splice site probably benign
R1312:Eml6 UTSW 11 29,781,219 (GRCm39) splice site probably benign
R1355:Eml6 UTSW 11 29,783,085 (GRCm39) missense probably benign 0.03
R1370:Eml6 UTSW 11 29,783,085 (GRCm39) missense probably benign 0.03
R1457:Eml6 UTSW 11 29,974,459 (GRCm39) missense probably damaging 1.00
R1486:Eml6 UTSW 11 29,755,114 (GRCm39) missense possibly damaging 0.83
R1511:Eml6 UTSW 11 29,768,374 (GRCm39) missense probably damaging 1.00
R1532:Eml6 UTSW 11 29,742,256 (GRCm39) splice site probably null
R1642:Eml6 UTSW 11 29,727,001 (GRCm39) critical splice donor site probably null
R1682:Eml6 UTSW 11 29,709,065 (GRCm39) missense probably benign 0.13
R1687:Eml6 UTSW 11 29,783,187 (GRCm39) missense probably damaging 1.00
R1699:Eml6 UTSW 11 29,696,282 (GRCm39) nonsense probably null
R1796:Eml6 UTSW 11 29,831,975 (GRCm39) missense probably benign 0.19
R1797:Eml6 UTSW 11 29,832,041 (GRCm39) missense probably benign 0.09
R1837:Eml6 UTSW 11 29,699,802 (GRCm39) splice site probably null
R1874:Eml6 UTSW 11 29,781,136 (GRCm39) missense probably damaging 0.99
R1967:Eml6 UTSW 11 29,974,545 (GRCm39) missense probably damaging 1.00
R1969:Eml6 UTSW 11 29,783,075 (GRCm39) missense probably benign
R2007:Eml6 UTSW 11 29,798,814 (GRCm39) critical splice donor site probably null
R2012:Eml6 UTSW 11 29,781,128 (GRCm39) missense possibly damaging 0.85
R2198:Eml6 UTSW 11 29,800,935 (GRCm39) missense probably benign 0.01
R2217:Eml6 UTSW 11 29,768,907 (GRCm39) missense probably damaging 1.00
R2218:Eml6 UTSW 11 29,768,907 (GRCm39) missense probably damaging 1.00
R2403:Eml6 UTSW 11 29,752,434 (GRCm39) missense probably benign 0.05
R2520:Eml6 UTSW 11 29,741,993 (GRCm39) missense probably damaging 1.00
R2937:Eml6 UTSW 11 29,783,049 (GRCm39) splice site probably benign
R2938:Eml6 UTSW 11 29,783,049 (GRCm39) splice site probably benign
R3085:Eml6 UTSW 11 29,759,332 (GRCm39) missense probably damaging 0.96
R3236:Eml6 UTSW 11 29,781,097 (GRCm39) critical splice donor site probably null
R3738:Eml6 UTSW 11 29,753,137 (GRCm39) missense probably benign 0.20
R3739:Eml6 UTSW 11 29,753,137 (GRCm39) missense probably benign 0.20
R3752:Eml6 UTSW 11 29,759,360 (GRCm39) missense probably benign 0.06
R3854:Eml6 UTSW 11 29,699,905 (GRCm39) missense possibly damaging 0.76
R3941:Eml6 UTSW 11 29,753,167 (GRCm39) missense probably damaging 0.98
R4034:Eml6 UTSW 11 29,753,137 (GRCm39) missense probably benign 0.20
R4049:Eml6 UTSW 11 29,788,577 (GRCm39) missense probably damaging 1.00
R4108:Eml6 UTSW 11 29,755,136 (GRCm39) missense probably damaging 0.98
R4657:Eml6 UTSW 11 29,755,108 (GRCm39) missense possibly damaging 0.77
R4662:Eml6 UTSW 11 29,727,390 (GRCm39) missense probably damaging 1.00
R4665:Eml6 UTSW 11 29,769,007 (GRCm39) nonsense probably null
R4721:Eml6 UTSW 11 29,788,525 (GRCm39) missense possibly damaging 0.95
R4729:Eml6 UTSW 11 29,783,204 (GRCm39) missense probably damaging 1.00
R4766:Eml6 UTSW 11 29,755,757 (GRCm39) missense probably benign 0.22
R4810:Eml6 UTSW 11 29,705,011 (GRCm39) missense possibly damaging 0.92
R4831:Eml6 UTSW 11 29,727,052 (GRCm39) nonsense probably null
R5035:Eml6 UTSW 11 29,804,187 (GRCm39) missense probably benign 0.00
R5064:Eml6 UTSW 11 29,699,300 (GRCm39) missense probably benign 0.12
R5103:Eml6 UTSW 11 29,800,905 (GRCm39) missense possibly damaging 0.65
R5161:Eml6 UTSW 11 29,974,467 (GRCm39) missense probably damaging 0.99
R5211:Eml6 UTSW 11 29,804,145 (GRCm39) missense probably benign 0.02
R5268:Eml6 UTSW 11 29,753,108 (GRCm39) missense probably benign 0.15
R5390:Eml6 UTSW 11 29,710,096 (GRCm39) missense probably damaging 1.00
R5529:Eml6 UTSW 11 29,714,126 (GRCm39) missense probably benign 0.04
R6239:Eml6 UTSW 11 29,699,275 (GRCm39) missense probably damaging 1.00
R6326:Eml6 UTSW 11 29,769,066 (GRCm39) missense probably damaging 1.00
R6395:Eml6 UTSW 11 29,759,321 (GRCm39) missense probably benign 0.00
R6476:Eml6 UTSW 11 29,741,971 (GRCm39) critical splice donor site probably null
R6483:Eml6 UTSW 11 29,699,875 (GRCm39) missense probably benign 0.00
R6701:Eml6 UTSW 11 29,735,748 (GRCm39) missense probably damaging 0.98
R6753:Eml6 UTSW 11 29,704,987 (GRCm39) missense probably damaging 1.00
R6809:Eml6 UTSW 11 29,753,161 (GRCm39) missense probably benign 0.23
R6847:Eml6 UTSW 11 29,768,447 (GRCm39) missense probably benign 0.00
R6855:Eml6 UTSW 11 29,701,381 (GRCm39) splice site probably null
R7168:Eml6 UTSW 11 29,788,529 (GRCm39) missense probably benign 0.01
R7175:Eml6 UTSW 11 29,734,231 (GRCm39) missense probably benign 0.00
R7305:Eml6 UTSW 11 29,727,258 (GRCm39) missense probably benign 0.01
R7615:Eml6 UTSW 11 29,752,501 (GRCm39) missense possibly damaging 0.49
R7692:Eml6 UTSW 11 29,703,085 (GRCm39) missense probably damaging 0.98
R7980:Eml6 UTSW 11 29,783,205 (GRCm39) missense probably damaging 1.00
R8026:Eml6 UTSW 11 29,699,973 (GRCm39) missense possibly damaging 0.63
R8046:Eml6 UTSW 11 29,708,981 (GRCm39) missense probably damaging 0.99
R8049:Eml6 UTSW 11 29,843,201 (GRCm39) missense possibly damaging 0.95
R8114:Eml6 UTSW 11 29,704,910 (GRCm39) missense probably damaging 1.00
R8425:Eml6 UTSW 11 29,705,008 (GRCm39) missense probably benign 0.00
R8799:Eml6 UTSW 11 29,708,981 (GRCm39) missense probably benign 0.11
R8945:Eml6 UTSW 11 29,703,110 (GRCm39) missense probably damaging 0.98
R8977:Eml6 UTSW 11 29,734,182 (GRCm39) missense possibly damaging 0.59
R8986:Eml6 UTSW 11 29,755,181 (GRCm39) missense possibly damaging 0.92
R9088:Eml6 UTSW 11 29,768,424 (GRCm39) missense probably damaging 0.96
R9150:Eml6 UTSW 11 29,755,791 (GRCm39) missense probably benign 0.15
R9209:Eml6 UTSW 11 29,781,175 (GRCm39) missense probably damaging 1.00
R9288:Eml6 UTSW 11 29,788,641 (GRCm39) critical splice acceptor site probably null
R9467:Eml6 UTSW 11 29,769,076 (GRCm39) missense probably damaging 0.99
R9481:Eml6 UTSW 11 29,788,641 (GRCm39) critical splice acceptor site probably null
R9534:Eml6 UTSW 11 29,734,155 (GRCm39) missense possibly damaging 0.45
RF037:Eml6 UTSW 11 29,702,549 (GRCm39) critical splice acceptor site probably benign
RF039:Eml6 UTSW 11 29,702,551 (GRCm39) critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- AGGTTTTAGTCTCCAGAACAGAAG -3'
(R):5'- CAGACATGGTGGCTCACATC -3'

Sequencing Primer
(F):5'- TTTTAGTCTCCAGAACAGAAGCAAAC -3'
(R):5'- GACATGGTGGCTCACATCTATAATCC -3'
Posted On 2016-06-15