Incidental Mutation 'R5121:Pcdhb5'
ID 393079
Institutional Source Beutler Lab
Gene Symbol Pcdhb5
Ensembl Gene ENSMUSG00000063687
Gene Name protocadherin beta 5
Synonyms PcdhbE, Pcdhb4A
MMRRC Submission 042709-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R5121 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 37453434-37456966 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37454170 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 183 (N183K)
Ref Sequence ENSEMBL: ENSMUSP00000077389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078271] [ENSMUST00000115661] [ENSMUST00000194544]
AlphaFold Q91XZ5
Predicted Effect probably benign
Transcript: ENSMUST00000078271
AA Change: N183K

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000077389
Gene: ENSMUSG00000063687
AA Change: N183K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 46 130 1.55e0 SMART
CA 154 239 2.42e-18 SMART
CA 263 344 1.27e-26 SMART
CA 367 448 1.14e-23 SMART
CA 472 558 2.38e-26 SMART
CA 588 669 7.06e-11 SMART
Pfam:Cadherin_C_2 686 769 3.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c A G 2: 58,171,662 (GRCm39) I234T probably damaging Het
Adam24 A G 8: 41,132,550 (GRCm39) E6G probably damaging Het
Amz1 A G 5: 140,729,919 (GRCm39) D151G probably benign Het
Arhgap24 T C 5: 102,989,201 (GRCm39) L10P probably damaging Het
Arhgap25 T G 6: 87,509,846 (GRCm39) N8T probably benign Het
Arsi T G 18: 61,050,511 (GRCm39) F465V probably damaging Het
Atp2c1 A G 9: 105,326,024 (GRCm39) V293A probably damaging Het
Bzw2 A G 12: 36,154,350 (GRCm39) L340P probably damaging Het
Camkmt C T 17: 85,404,009 (GRCm39) T77I probably benign Het
Camsap1 G T 2: 25,825,562 (GRCm39) Q1375K probably benign Het
Catsper2 G T 2: 121,227,604 (GRCm39) probably null Het
Cd163 T C 6: 124,294,948 (GRCm39) C671R probably damaging Het
Cdk7 T C 13: 100,854,192 (GRCm39) probably null Het
Cfi C T 3: 129,666,726 (GRCm39) P483L probably damaging Het
Chn2 C T 6: 54,195,546 (GRCm39) L72F possibly damaging Het
Cimip4 C T 15: 78,270,373 (GRCm39) E132K probably benign Het
Cntn2 C A 1: 132,444,798 (GRCm39) E363* probably null Het
Crebbp T C 16: 3,911,375 (GRCm39) E999G probably damaging Het
Cspp1 T A 1: 10,196,688 (GRCm39) N900K probably damaging Het
Cts3 A C 13: 61,715,409 (GRCm39) I141M probably benign Het
Cwc27 A T 13: 104,940,861 (GRCm39) V166D probably damaging Het
Defb26 T C 2: 152,350,085 (GRCm39) E65G possibly damaging Het
Dnah8 A G 17: 31,029,327 (GRCm39) T4099A probably benign Het
Eml6 A G 11: 29,694,606 (GRCm39) F1953L probably benign Het
Etl4 T A 2: 20,344,922 (GRCm39) probably null Het
Fbln1 A G 15: 85,121,872 (GRCm39) E331G probably damaging Het
Gabra4 G A 5: 71,729,546 (GRCm39) H76Y probably benign Het
Gcat T C 15: 78,919,482 (GRCm39) V149A probably damaging Het
Glp2r A T 11: 67,612,926 (GRCm39) probably null Het
Gm572 T C 4: 148,751,302 (GRCm39) probably null Het
Golgb1 T C 16: 36,739,620 (GRCm39) V2653A probably damaging Het
Grap2 G A 15: 80,530,345 (GRCm39) R155Q possibly damaging Het
Gspt1 T A 16: 11,041,165 (GRCm39) I533L probably damaging Het
Gypa A T 8: 81,222,977 (GRCm39) Y27F unknown Het
Hipk4 G A 7: 27,228,917 (GRCm39) V456I probably benign Het
Homer2 A T 7: 81,299,311 (GRCm39) D51E probably benign Het
Hspa1b A T 17: 35,176,980 (GRCm39) V335E possibly damaging Het
Ift122 A G 6: 115,889,495 (GRCm39) T827A probably benign Het
Igkv1-35 T C 6: 69,988,119 (GRCm39) N58S probably benign Het
Kat6b A T 14: 21,669,326 (GRCm39) H297L probably damaging Het
Kirrel3 G T 9: 34,924,601 (GRCm39) G296W probably damaging Het
Klhl17 A G 4: 156,315,082 (GRCm39) V525A probably benign Het
Lrrn1 G T 6: 107,546,168 (GRCm39) R655S possibly damaging Het
Ltk T C 2: 119,583,708 (GRCm39) N256D probably damaging Het
Mill2 G A 7: 18,590,591 (GRCm39) G209S probably benign Het
Mmp27 A T 9: 7,581,369 (GRCm39) H544L probably benign Het
Mphosph10 A G 7: 64,039,344 (GRCm39) S209P probably damaging Het
Mphosph8 A T 14: 56,914,003 (GRCm39) K415* probably null Het
Myb T A 10: 21,002,137 (GRCm39) M616L probably benign Het
Myo15b C T 11: 115,776,880 (GRCm39) R867W probably damaging Het
Myo18b A T 5: 113,022,346 (GRCm39) probably benign Het
Nip7 A G 8: 107,783,589 (GRCm39) E8G possibly damaging Het
Optn T A 2: 5,050,917 (GRCm39) I155F probably benign Het
Or2f1b T A 6: 42,739,931 (GRCm39) L315* probably null Het
Or4f62 A T 2: 111,986,631 (GRCm39) M112L possibly damaging Het
Or52e4 A G 7: 104,705,689 (GRCm39) T79A possibly damaging Het
Or5c1 T G 2: 37,222,601 (GRCm39) F281V probably damaging Het
Or6b6 T C 7: 106,571,438 (GRCm39) I38V probably benign Het
Papolb A T 5: 142,514,592 (GRCm39) H350Q probably benign Het
Pappa2 T A 1: 158,666,197 (GRCm39) M1128L probably benign Het
Pde12 G T 14: 26,390,577 (GRCm39) S44* probably null Het
Peg3 T C 7: 6,713,288 (GRCm39) K645E probably benign Het
Pkd1 C T 17: 24,792,437 (GRCm39) R1375C probably benign Het
Plekha5 G A 6: 140,525,200 (GRCm39) E21K probably damaging Het
Plk2 C T 13: 110,535,958 (GRCm39) P554L probably benign Het
Pnkp C T 7: 44,511,827 (GRCm39) S113L probably damaging Het
Polg A T 7: 79,114,353 (GRCm39) W203R probably damaging Het
Ppcdc A G 9: 57,328,446 (GRCm39) V65A possibly damaging Het
Ppm1m T A 9: 106,073,004 (GRCm39) Q353L probably benign Het
Ppp1r13l G C 7: 19,104,020 (GRCm39) R167P probably damaging Het
Ppp1r9b T A 11: 94,887,479 (GRCm39) V497E probably damaging Het
Prpf6 T A 2: 181,277,836 (GRCm39) H399Q probably benign Het
Psg25 T A 7: 18,260,461 (GRCm39) I146F possibly damaging Het
Rasgef1c A T 11: 49,851,256 (GRCm39) Q116L probably damaging Het
Rbbp9 A G 2: 144,392,676 (GRCm39) V8A possibly damaging Het
Rfk T C 19: 17,376,930 (GRCm39) F144S probably damaging Het
Rfwd3 A C 8: 112,009,385 (GRCm39) probably null Het
Rhpn1 T C 15: 75,581,109 (GRCm39) I117T probably damaging Het
Sars2 A T 7: 28,447,333 (GRCm39) N244Y probably damaging Het
Scnn1b A T 7: 121,502,110 (GRCm39) H256L probably benign Het
Sgcz G A 8: 38,006,821 (GRCm39) T195I probably damaging Het
Sh3gl2 T A 4: 85,297,494 (GRCm39) H157Q probably benign Het
Spen T A 4: 141,203,410 (GRCm39) Q1739L probably benign Het
Susd1 G T 4: 59,379,657 (GRCm39) S323R possibly damaging Het
Szt2 T C 4: 118,242,641 (GRCm39) E1482G possibly damaging Het
Tex15 A T 8: 34,061,794 (GRCm39) K408I probably damaging Het
Trem1 T A 17: 48,539,864 (GRCm39) F14L probably null Het
Trim26 G T 17: 37,161,958 (GRCm39) E126* probably null Het
Trpv3 T C 11: 73,168,660 (GRCm39) probably null Het
Ttn T A 2: 76,746,835 (GRCm39) probably null Het
Ubap1 C T 4: 41,379,688 (GRCm39) L301F probably benign Het
Uchl1 T C 5: 66,833,780 (GRCm39) M12T probably benign Het
Vill C T 9: 118,899,093 (GRCm39) T253I possibly damaging Het
Vmn2r107 C T 17: 20,576,015 (GRCm39) T115I probably benign Het
Vmn2r98 T C 17: 19,273,815 (GRCm39) S21P probably benign Het
Wapl A G 14: 34,399,119 (GRCm39) K63E probably benign Het
Wnt2 T C 6: 18,023,125 (GRCm39) K175E possibly damaging Het
Zfp592 T C 7: 80,673,309 (GRCm39) L91P probably damaging Het
Zfp74 T C 7: 29,631,932 (GRCm39) probably null Het
Zglp1 A T 9: 20,973,957 (GRCm39) I243N probably benign Het
Zranb1 A G 7: 132,551,916 (GRCm39) E215G probably benign Het
Other mutations in Pcdhb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Pcdhb5 APN 18 37,455,162 (GRCm39) missense probably damaging 1.00
IGL00895:Pcdhb5 APN 18 37,454,036 (GRCm39) missense probably benign 0.42
IGL00896:Pcdhb5 APN 18 37,455,838 (GRCm39) splice site probably null
IGL01385:Pcdhb5 APN 18 37,455,267 (GRCm39) missense probably benign 0.00
IGL01619:Pcdhb5 APN 18 37,455,992 (GRCm39) missense probably damaging 1.00
IGL01712:Pcdhb5 APN 18 37,454,306 (GRCm39) missense probably damaging 1.00
IGL01716:Pcdhb5 APN 18 37,454,075 (GRCm39) missense probably benign
IGL01719:Pcdhb5 APN 18 37,454,075 (GRCm39) missense probably benign
IGL01720:Pcdhb5 APN 18 37,454,075 (GRCm39) missense probably benign
IGL01723:Pcdhb5 APN 18 37,454,075 (GRCm39) missense probably benign
IGL01724:Pcdhb5 APN 18 37,454,075 (GRCm39) missense probably benign
IGL01839:Pcdhb5 APN 18 37,454,502 (GRCm39) missense probably damaging 0.98
IGL01884:Pcdhb5 APN 18 37,454,387 (GRCm39) missense probably benign 0.00
IGL01962:Pcdhb5 APN 18 37,454,093 (GRCm39) missense probably damaging 1.00
IGL02088:Pcdhb5 APN 18 37,455,012 (GRCm39) missense probably benign 0.11
IGL02299:Pcdhb5 APN 18 37,453,943 (GRCm39) missense probably benign
IGL02444:Pcdhb5 APN 18 37,454,103 (GRCm39) missense probably benign 0.01
IGL03372:Pcdhb5 APN 18 37,453,713 (GRCm39) missense probably benign 0.22
R0034:Pcdhb5 UTSW 18 37,455,137 (GRCm39) missense probably damaging 1.00
R0047:Pcdhb5 UTSW 18 37,454,321 (GRCm39) missense possibly damaging 0.87
R0179:Pcdhb5 UTSW 18 37,455,612 (GRCm39) missense probably damaging 1.00
R0466:Pcdhb5 UTSW 18 37,455,596 (GRCm39) missense probably damaging 1.00
R0471:Pcdhb5 UTSW 18 37,454,359 (GRCm39) nonsense probably null
R0565:Pcdhb5 UTSW 18 37,453,820 (GRCm39) missense possibly damaging 0.91
R0646:Pcdhb5 UTSW 18 37,454,675 (GRCm39) missense probably benign
R1014:Pcdhb5 UTSW 18 37,455,303 (GRCm39) missense probably damaging 1.00
R1617:Pcdhb5 UTSW 18 37,454,455 (GRCm39) nonsense probably null
R1676:Pcdhb5 UTSW 18 37,453,805 (GRCm39) missense probably benign 0.01
R1774:Pcdhb5 UTSW 18 37,455,725 (GRCm39) missense probably damaging 0.99
R1826:Pcdhb5 UTSW 18 37,454,522 (GRCm39) nonsense probably null
R1854:Pcdhb5 UTSW 18 37,455,393 (GRCm39) missense possibly damaging 0.94
R2355:Pcdhb5 UTSW 18 37,455,169 (GRCm39) missense probably benign
R4290:Pcdhb5 UTSW 18 37,455,734 (GRCm39) missense possibly damaging 0.90
R4292:Pcdhb5 UTSW 18 37,455,734 (GRCm39) missense possibly damaging 0.90
R4293:Pcdhb5 UTSW 18 37,455,734 (GRCm39) missense possibly damaging 0.90
R4294:Pcdhb5 UTSW 18 37,455,734 (GRCm39) missense possibly damaging 0.90
R4295:Pcdhb5 UTSW 18 37,455,734 (GRCm39) missense possibly damaging 0.90
R4391:Pcdhb5 UTSW 18 37,455,789 (GRCm39) missense possibly damaging 0.88
R4411:Pcdhb5 UTSW 18 37,455,050 (GRCm39) missense possibly damaging 0.80
R4480:Pcdhb5 UTSW 18 37,453,805 (GRCm39) missense probably benign 0.43
R4852:Pcdhb5 UTSW 18 37,455,524 (GRCm39) missense probably benign 0.04
R5133:Pcdhb5 UTSW 18 37,453,943 (GRCm39) missense probably benign
R5630:Pcdhb5 UTSW 18 37,454,208 (GRCm39) missense possibly damaging 0.88
R5833:Pcdhb5 UTSW 18 37,454,155 (GRCm39) missense probably damaging 0.99
R5896:Pcdhb5 UTSW 18 37,455,732 (GRCm39) nonsense probably null
R5942:Pcdhb5 UTSW 18 37,453,838 (GRCm39) nonsense probably null
R5945:Pcdhb5 UTSW 18 37,454,523 (GRCm39) missense probably benign 0.08
R5970:Pcdhb5 UTSW 18 37,454,826 (GRCm39) missense probably damaging 1.00
R6045:Pcdhb5 UTSW 18 37,454,628 (GRCm39) missense probably damaging 1.00
R6054:Pcdhb5 UTSW 18 37,454,133 (GRCm39) missense probably damaging 0.98
R6147:Pcdhb5 UTSW 18 37,453,779 (GRCm39) missense probably damaging 1.00
R6152:Pcdhb5 UTSW 18 37,455,886 (GRCm39) nonsense probably null
R6193:Pcdhb5 UTSW 18 37,455,080 (GRCm39) missense probably damaging 1.00
R6397:Pcdhb5 UTSW 18 37,454,558 (GRCm39) missense probably benign 0.08
R6505:Pcdhb5 UTSW 18 37,453,933 (GRCm39) missense probably benign 0.00
R6608:Pcdhb5 UTSW 18 37,454,876 (GRCm39) missense probably damaging 0.98
R6737:Pcdhb5 UTSW 18 37,455,723 (GRCm39) missense probably damaging 1.00
R7146:Pcdhb5 UTSW 18 37,454,409 (GRCm39) missense probably damaging 1.00
R7162:Pcdhb5 UTSW 18 37,454,739 (GRCm39) missense probably benign 0.16
R7584:Pcdhb5 UTSW 18 37,455,425 (GRCm39) missense possibly damaging 0.90
R8214:Pcdhb5 UTSW 18 37,454,636 (GRCm39) missense probably benign 0.37
R8327:Pcdhb5 UTSW 18 37,453,953 (GRCm39) missense probably benign 0.00
R8676:Pcdhb5 UTSW 18 37,454,129 (GRCm39) missense probably benign 0.01
R9234:Pcdhb5 UTSW 18 37,453,695 (GRCm39) missense probably benign
R9424:Pcdhb5 UTSW 18 37,454,120 (GRCm39) missense probably damaging 1.00
R9505:Pcdhb5 UTSW 18 37,454,664 (GRCm39) missense possibly damaging 0.87
R9635:Pcdhb5 UTSW 18 37,454,510 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GTTCCTAGAAAAGCCAGTGCAG -3'
(R):5'- TCACAAACTCAGGAGCATTGTC -3'

Sequencing Primer
(F):5'- GATCCAGGATATAAATGACAACTCG -3'
(R):5'- CATTGATGTCCATGATCAGGATTCG -3'
Posted On 2016-06-15