Mutagenetix > Incidental Mutations

Incidental Mutation 'R5038:Stat1'

393085

Institutional Source

Beutler Lab

Gene Symbol

Stat1

Ensembl Gene

ENSMUSG00000026104

Gene Name

signal transducer and activator of transcription 1

Synonyms

2010005J02Rik

MMRRC Submission

042628-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5038 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52119440-52161865 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 52123209 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 75 (N75I)

Ref Sequence

ENSEMBL: ENSMUSP00000141144 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070968] [ENSMUST00000186057] [ENSMUST00000186574] [ENSMUST00000186857] [ENSMUST00000188681] [ENSMUST00000189347] [ENSMUST00000191435]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000070968
AA Change: N75I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000066743
Gene: ENSMUSG00000026104
AA Change: N75I

Domain	Start	End	E-Value	Type
STAT_int	2	122	2.5e-61	SMART
Pfam:STAT_alpha	139	315	1.4e-56	PFAM
Pfam:STAT_bind	317	566	4.2e-82	PFAM
SH2	571	687	1.59e-1	SMART
Pfam:STAT1_TAZ2bind	715	739	2.4e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185516

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185743

Predicted Effect

probably damaging
Transcript: ENSMUST00000186057
AA Change: N75I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000141132
Gene: ENSMUSG00000026104
AA Change: N75I

Domain	Start	End	E-Value	Type
STAT_int	2	122	2.5e-61	SMART
Pfam:STAT_alpha	136	315	3.4e-65	PFAM
Pfam:STAT_bind	317	573	3.9e-118	PFAM
SH2	577	693	1.59e-1	SMART
Pfam:STAT1_TAZ2bind	721	745	2.3e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186186

Predicted Effect

probably damaging
Transcript: ENSMUST00000186574
AA Change: N75I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140518
Gene: ENSMUSG00000026104
AA Change: N75I

Domain	Start	End	E-Value	Type
STAT_int	2	122	1.9e-65	SMART
Pfam:STAT_alpha	136	315	3.3e-62	PFAM
Pfam:STAT_bind	317	567	1.1e-118	PFAM
SH2	571	687	1e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186857
AA Change: N75I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140875
Gene: ENSMUSG00000026104
AA Change: N75I

Domain	Start	End	E-Value	Type
STAT_int	2	122	2.5e-61	SMART
Pfam:STAT_alpha	136	315	1.2e-64	PFAM
Pfam:STAT_bind	317	567	4.4e-121	PFAM
SH2	571	687	1.59e-1	SMART
Pfam:STAT1_TAZ2bind	715	739	3.1e-15	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000188681
AA Change: N75I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141144
Gene: ENSMUSG00000026104
AA Change: N75I

Domain	Start	End	E-Value	Type
STAT_int	2	122	1.9e-65	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000189347
AA Change: N75I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000141125
Gene: ENSMUSG00000026104
AA Change: N75I

Domain	Start	End	E-Value	Type
STAT_int	2	122	1.9e-65	SMART
Pfam:STAT_alpha	136	315	3.3e-62	PFAM
Pfam:STAT_bind	317	567	1.1e-118	PFAM
SH2	571	687	1e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000191435
AA Change: N75I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139746
Gene: ENSMUSG00000026104
AA Change: N75I

Domain	Start	End	E-Value	Type
STAT_int	2	122	1.9e-65	SMART
Pfam:STAT_alpha	136	315	3.3e-62	PFAM
Pfam:STAT_bind	317	567	1.1e-118	PFAM
SH2	571	687	1e-3	SMART

Meta Mutation Damage Score

0.8967

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.5%

Validation Efficiency

94% (64/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein can be activated by various ligands including interferon-alpha, interferon-gamma, EGF, PDGF and IL6. This protein mediates the expression of a variety of genes, which is thought to be important for cell viability in response to different cell stimuli and pathogens. Two alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are largely unresponsive to interferon, fail to thrive, are susceptible to viral diseases and cutaneous leishmaniasis, and show excess osteoclastogenesis leading to increased bone mass. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930512M02Rik	A	T	11: 11,589,375		probably null	Het
Abtb2	G	T	2: 103,567,063	G113C	probably damaging	Het
Acsm5	A	G	7: 119,534,811	T272A	probably damaging	Het
Adprhl2	C	T	4: 126,317,309	E272K	possibly damaging	Het
Agbl5	G	A	5: 30,903,059	R141Q	probably damaging	Het
Atp7b	A	C	8: 22,028,456	I122S	possibly damaging	Het
B230219D22Rik	T	C	13: 55,699,475	Y134H	probably damaging	Het
Bnc1	A	G	7: 81,968,714	S868P	probably damaging	Het
Camta1	T	C	4: 151,145,469	E302G	probably damaging	Het
Car1	A	G	3: 14,770,873	Y129H	probably damaging	Het
Cdh22	T	C	2: 165,142,277	T352A	probably benign	Het
Ckmt2	T	C	13: 91,861,163	E215G	probably benign	Het
Cyb5r4	T	G	9: 87,059,077		probably null	Het
Dhrs13	A	G	11: 78,032,430		probably benign	Het
Dsg1c	G	A	18: 20,264,844	A34T	probably benign	Het
Epb41l1	T	C	2: 156,521,410	V613A	probably benign	Het
Fam114a1	A	G	5: 65,009,045	M240V	probably damaging	Het
Gm15455	T	C	1: 33,838,176		noncoding transcript	Het
Herc1	T	G	9: 66,476,460		probably benign	Het
Ifna11	T	C	4: 88,820,077	V40A	probably benign	Het
Ifna15	T	C	4: 88,558,029	N73D	probably benign	Het
Imp4	A	T	1: 34,442,935	L45F	probably damaging	Het
Jak3	G	A	8: 71,686,058	A967T	probably damaging	Het
Krtap19-2	A	T	16: 88,874,028	Y76*	probably null	Het
Map4k5	A	T	12: 69,824,614	N492K	probably damaging	Het
Mycbp2	C	T	14: 103,296,939	R372H	probably damaging	Het
Nos2	G	A	11: 78,922,314	S16N	probably benign	Het
Nr2c2	A	G	6: 92,139,822	T2A	probably damaging	Het
Nup188	T	C	2: 30,309,220	Y267H	probably damaging	Het
Nxph2	G	A	2: 23,321,544		probably null	Het
Olfr1446	T	A	19: 12,890,406	H57L	probably damaging	Het
Olfr1461	T	A	19: 13,165,591	D192E	probably benign	Het
Olfr1505	T	A	19: 13,919,458	V146E	possibly damaging	Het
Otof	C	T	5: 30,384,439	E761K	possibly damaging	Het
Pik3r1	C	T	13: 101,689,444	R37Q	probably damaging	Het
Pkn3	T	C	2: 30,085,281		probably null	Het
Pold3	A	G	7: 100,121,383	V14A	probably damaging	Het
Ptpn14	T	C	1: 189,786,886	S38P	probably damaging	Het
Raf1	G	A	6: 115,620,235	Q35*	probably null	Het
Rps3a1	C	A	3: 86,138,031	E251D	probably benign	Het
Scd1	C	T	19: 44,401,709	V207M	probably damaging	Het
Shq1	A	G	6: 100,630,993	V319A	probably benign	Het
Slc4a8	T	C	15: 100,795,821	Y416H	probably damaging	Het
Slco1a5	C	T	6: 142,266,364	G90D	probably damaging	Het
Slco1a5	T	C	6: 142,262,637	T143A	probably benign	Het
Snx9	T	C	17: 5,887,073	V30A	probably benign	Het
Spdya	T	C	17: 71,588,566		probably benign	Het
Sv2b	A	T	7: 75,157,425	M159K	probably damaging	Het
Tdh	A	T	14: 63,496,126	Y89*	probably null	Het
Tmc7	A	G	7: 118,543,365	F600S	probably damaging	Het
Trpa1	T	A	1: 14,910,866	H104L	probably damaging	Het
Ttn	G	A	2: 76,848,640		probably benign	Het
Vmn1r113	A	G	7: 20,787,494	I70M	possibly damaging	Het
Vmn1r171	A	G	7: 23,632,763	M138V	probably benign	Het
Zfc3h1	G	A	10: 115,404,211	V550I	probably benign	Het
Zfp335	G	T	2: 164,910,644	S60*	probably null	Het
Zfp7	T	C	15: 76,891,810	M684T	probably benign	Het
Zfp984	T	A	4: 147,755,446	H316L	probably damaging	Het
Zmym2	T	A	14: 56,956,180	Y1151N	possibly damaging	Het

Other mutations in Stat1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Stat1	APN	1	52122595	start codon destroyed	probably null	0.50
IGL01111:Stat1	APN	1	52142961	critical splice donor site	probably null
IGL01451:Stat1	APN	1	52139343	missense	probably damaging	1.00
IGL01469:Stat1	APN	1	52147370	missense	possibly damaging	0.87
IGL01758:Stat1	APN	1	52136921	missense	probably damaging	1.00
IGL01818:Stat1	APN	1	52151278	missense	probably damaging	1.00
IGL01913:Stat1	APN	1	52126557	missense	probably benign	0.08
IGL01914:Stat1	APN	1	52126557	missense	probably benign	0.08
IGL02304:Stat1	APN	1	52132544	missense	probably benign
IGL02428:Stat1	APN	1	52142966	splice site	probably benign
Accretion	UTSW	1	52135621	missense	possibly damaging	0.65
baroque	UTSW	1	52144209	missense	probably damaging	1.00
Compounding	UTSW	1	52151281	missense	probably benign	0.17
domino	UTSW	1	52140588	missense	probably damaging	1.00
h_moll	UTSW	1	52139194	nonsense	probably null
kun_ming	UTSW	1	52137416	missense	possibly damaging	0.52
kuomintang	UTSW	1	52151245	missense	possibly damaging	0.51
poison	UTSW	1	52151225	splice site	probably benign
roccoco	UTSW	1	52123209	missense	probably damaging	1.00
rollo	UTSW	1	52153923	nonsense	probably null
special	UTSW	1	52139264	missense	probably damaging	1.00
vandegraff	UTSW	1	52155019	missense	probably benign	0.01
R0022:Stat1	UTSW	1	52140630	missense	probably damaging	1.00
R0022:Stat1	UTSW	1	52140630	missense	probably damaging	1.00
R0039:Stat1	UTSW	1	52140660	missense	probably damaging	0.99
R0458:Stat1	UTSW	1	52149052	splice site	probably benign
R1313:Stat1	UTSW	1	52156006	missense	probably damaging	0.98
R1313:Stat1	UTSW	1	52156006	missense	probably damaging	0.98
R2998:Stat1	UTSW	1	52151249	missense	probably benign	0.01
R4464:Stat1	UTSW	1	52137416	missense	possibly damaging	0.52
R4709:Stat1	UTSW	1	52126521	missense	probably damaging	0.97
R4934:Stat1	UTSW	1	52153923	nonsense	probably null
R5075:Stat1	UTSW	1	52122712	missense	possibly damaging	0.73
R5223:Stat1	UTSW	1	52144242	missense	probably damaging	1.00
R5600:Stat1	UTSW	1	52148942	missense	probably benign	0.06
R5866:Stat1	UTSW	1	52139264	missense	probably damaging	1.00
R7105:Stat1	UTSW	1	52151249	missense	probably benign	0.01
R7192:Stat1	UTSW	1	52135621	missense	possibly damaging	0.65
R7284:Stat1	UTSW	1	52148922	missense	probably benign	0.01
R7309:Stat1	UTSW	1	52126621	splice site	probably null
R7491:Stat1	UTSW	1	52152371	missense	probably benign	0.31
R7680:Stat1	UTSW	1	52144209	missense	probably damaging	1.00
R7825:Stat1	UTSW	1	52151308	missense	probably damaging	0.98
R7915:Stat1	UTSW	1	52151281	missense	probably benign	0.17
R8245:Stat1	UTSW	1	52155019	missense	probably benign	0.01
R8309:Stat1	UTSW	1	52151245	missense	possibly damaging	0.51
R8728:Stat1	UTSW	1	52139194	nonsense	probably null
R8952:Stat1	UTSW	1	52147883	missense	probably benign	0.01
R9054:Stat1	UTSW	1	52142927	missense	probably damaging	1.00
R9156:Stat1	UTSW	1	52139229	missense	probably damaging	1.00
R9209:Stat1	UTSW	1	52145178	missense	probably benign
R9252:Stat1	UTSW	1	52135672	missense	probably benign	0.03
R9337:Stat1	UTSW	1	52152270	missense	probably benign	0.00
R9388:Stat1	UTSW	1	52153878	missense	possibly damaging	0.81
RF036:Stat1	UTSW	1	52152260	missense	probably benign
RF060:Stat1	UTSW	1	52152260	missense	probably benign
X0027:Stat1	UTSW	1	52139271	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAATGTCTGGCACTTCCTATAC -3'
(R):5'- CAGCCACATAAAGAGAGTGTATCTG -3'

Sequencing Primer
(F):5'- GTCAGTTGTGTGTGATAGAAACAC -3'
(R):5'- AGAGAGTGTATCTGTACTTCTGTAAC -3'

Posted On

2016-06-15