Incidental Mutation 'R0445:Oas3'
ID39310
Institutional Source Beutler Lab
Gene Symbol Oas3
Ensembl Gene ENSMUSG00000032661
Gene Name2'-5' oligoadenylate synthetase 3
SynonymsOasl10, 2'-5' oligoadenylate synthetase-like 10
MMRRC Submission 038646-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R0445 (G1)
Quality Score128
Status Validated
Chromosome5
Chromosomal Location120753098-120777661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120756145 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 39 (R39C)
Ref Sequence ENSEMBL: ENSMUSP00000125873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044833] [ENSMUST00000165820]
Predicted Effect probably damaging
Transcript: ENSMUST00000044833
AA Change: R1047C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035588
Gene: ENSMUSG00000032661
AA Change: R1047C

DomainStartEndE-ValueType
Pfam:OAS1_C 159 341 6.3e-83 PFAM
Pfam:OAS1_C 610 795 3.1e-78 PFAM
Pfam:NTP_transf_2 831 920 4.5e-11 PFAM
Pfam:OAS1_C 954 1136 9e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165820
AA Change: R39C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125873
Gene: ENSMUSG00000032661
AA Change: R39C

DomainStartEndE-ValueType
Pfam:OAS1_C 1 130 3.8e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200795
Meta Mutation Damage Score 0.454 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme included in the 2', 5' oligoadenylate synthase family. This enzyme is induced by interferons and catalyzes the 2', 5' oligomers of adenosine in order to bind and activate RNase L. This enzyme family plays a significant role in the inhibition of cellular protein synthesis and viral infection resistance. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A C 17: 48,090,022 probably null Het
4932438A13Rik T C 3: 37,000,065 V3111A probably damaging Het
A2m C T 6: 121,657,955 T687I probably damaging Het
Acsbg1 A G 9: 54,615,895 S483P probably damaging Het
Adam22 T A 5: 8,180,591 probably benign Het
Aggf1 A G 13: 95,354,001 V595A possibly damaging Het
Aplf A T 6: 87,663,752 L71I probably damaging Het
Arid3c G T 4: 41,725,172 P292T probably benign Het
Brms1l T A 12: 55,861,406 Y213* probably null Het
C87436 T A 6: 86,449,850 S332T possibly damaging Het
Cad G A 5: 31,072,709 A1454T probably benign Het
Cdkn3 T C 14: 46,767,400 probably null Het
Cnot1 A G 8: 95,760,208 C624R probably damaging Het
Cntnap5c A T 17: 58,104,743 I541F probably benign Het
Cyhr1 T C 15: 76,648,257 H217R probably damaging Het
Dennd1b A G 1: 139,167,765 probably benign Het
Dscam A T 16: 96,772,503 I753N probably damaging Het
Eef2 C CN 10: 81,178,770 probably null Het
Epg5 T A 18: 78,014,184 V1826D possibly damaging Het
Epha8 T C 4: 136,932,400 Y755C probably damaging Het
Esco1 A T 18: 10,574,989 N694K probably damaging Het
Fermt3 T C 19: 7,003,299 H300R probably benign Het
Galnt5 C A 2: 57,998,950 F187L probably benign Het
Gm17067 A G 7: 42,708,622 I152T probably benign Het
Gnb3 T C 6: 124,837,255 D154G possibly damaging Het
Gpr155 G A 2: 73,370,144 probably benign Het
Hdac3 A G 18: 37,943,724 I240T probably damaging Het
Ifitm1 A T 7: 140,968,441 probably null Het
Kif1b A T 4: 149,188,009 L1455Q probably benign Het
Krt1 A C 15: 101,847,621 L388R probably damaging Het
Lrp1 T A 10: 127,590,636 K635* probably null Het
Map3k2 A G 18: 32,217,210 Y371C probably damaging Het
Mcu T C 10: 59,456,645 probably benign Het
Mkrn1 C T 6: 39,404,854 V167I probably benign Het
Mrpl9 T A 3: 94,444,891 probably benign Het
Naip2 T C 13: 100,161,887 Y547C possibly damaging Het
Nup88 G A 11: 70,947,729 T487I probably benign Het
Obscn C T 11: 58,999,335 R7457H unknown Het
Olfr1383 T A 11: 49,523,957 V78E probably damaging Het
Olfr272 G A 4: 52,910,849 T315M probably benign Het
Paf1 T C 7: 28,395,688 S118P probably damaging Het
Parp4 T A 14: 56,602,748 probably null Het
Pcdh15 A T 10: 74,342,549 Y157F probably damaging Het
Pex10 G A 4: 155,069,074 probably null Het
Phrf1 C T 7: 141,247,331 probably benign Het
Polr3a G T 14: 24,454,921 D1090E probably benign Het
Ppfia4 A C 1: 134,327,289 L276R probably benign Het
Rdh16f1 T C 10: 127,790,867 L263S probably benign Het
Ryr3 T C 2: 112,866,054 D967G probably benign Het
Shc1 G T 3: 89,426,537 A226S probably damaging Het
Slc4a1 A G 11: 102,354,366 V585A probably benign Het
Stk38l T A 6: 146,775,686 S461T probably benign Het
Tbkbp1 A T 11: 97,149,469 S40T probably damaging Het
Tet1 A G 10: 62,879,941 M25T probably benign Het
Themis A G 10: 28,782,011 R192G probably damaging Het
Tmem144 T C 3: 79,825,354 T206A probably benign Het
Tmem74b G A 2: 151,706,959 R202H probably damaging Het
Trpm1 T C 7: 64,244,842 probably benign Het
Vars A G 17: 35,011,809 H557R probably benign Het
Zbtb12 C A 17: 34,896,301 A354E possibly damaging Het
Zfp143 A T 7: 110,061,117 probably benign Het
Other mutations in Oas3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Oas3 APN 5 120777442 splice site probably benign
IGL01095:Oas3 APN 5 120772889 missense probably damaging 1.00
IGL01835:Oas3 APN 5 120766128 nonsense probably null
IGL02006:Oas3 APN 5 120769235 missense probably benign 0.00
IGL02811:Oas3 APN 5 120764322 missense unknown
IGL03194:Oas3 APN 5 120758953 missense probably damaging 1.00
R0066:Oas3 UTSW 5 120758875 missense probably damaging 1.00
R0195:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0196:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0197:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0523:Oas3 UTSW 5 120766144 missense unknown
R0592:Oas3 UTSW 5 120771149 missense probably damaging 1.00
R0946:Oas3 UTSW 5 120769063 missense unknown
R1354:Oas3 UTSW 5 120770000 missense possibly damaging 0.94
R1642:Oas3 UTSW 5 120777574 missense possibly damaging 0.90
R1681:Oas3 UTSW 5 120769908 missense probably benign 0.22
R1844:Oas3 UTSW 5 120759980 missense probably damaging 0.99
R1981:Oas3 UTSW 5 120761835 splice site probably benign
R2443:Oas3 UTSW 5 120777488 missense probably benign 0.35
R2902:Oas3 UTSW 5 120758917 missense probably damaging 1.00
R3034:Oas3 UTSW 5 120771056 missense probably damaging 1.00
R4565:Oas3 UTSW 5 120771039 missense probably damaging 1.00
R4692:Oas3 UTSW 5 120769355 missense probably benign 0.03
R4723:Oas3 UTSW 5 120766256 missense unknown
R4812:Oas3 UTSW 5 120761147 unclassified probably benign
R5288:Oas3 UTSW 5 120756990 missense probably damaging 1.00
R5343:Oas3 UTSW 5 120756238 missense possibly damaging 0.70
R5494:Oas3 UTSW 5 120761644 missense unknown
R5688:Oas3 UTSW 5 120758802 missense probably benign 0.31
R5894:Oas3 UTSW 5 120756954 missense probably damaging 1.00
R5921:Oas3 UTSW 5 120769981 missense probably damaging 1.00
R6037:Oas3 UTSW 5 120769319 missense probably benign 0.41
R6037:Oas3 UTSW 5 120769319 missense probably benign 0.41
R6066:Oas3 UTSW 5 120772924 missense probably damaging 0.97
R6104:Oas3 UTSW 5 120761693 missense unknown
R6134:Oas3 UTSW 5 120769048 missense unknown
R6255:Oas3 UTSW 5 120771230 missense probably benign 0.04
R6257:Oas3 UTSW 5 120761135 unclassified probably benign
R6776:Oas3 UTSW 5 120758874 missense probably damaging 1.00
X0024:Oas3 UTSW 5 120761728 missense unknown
Predicted Primers PCR Primer
(F):5'- ACAGGTGACCCAGAAGCTGACTAC -3'
(R):5'- TGCCAATGTGAACCTACACATCTCC -3'

Sequencing Primer
(F):5'- AGCACCACTCTGGGAAGC -3'
(R):5'- GTGAACCTACACATCTCCTGTCC -3'
Posted On2013-05-23