Mutagenetix > Incidental Mutation

Incidental Mutation 'R5038:Otof'

393102

Institutional Source

Beutler Lab

Gene Symbol

Otof

Ensembl Gene

ENSMUSG00000062372

Gene Name

otoferlin

Synonyms

MMRRC Submission

042628-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R5038 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30524406-30619276 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 30541783 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 761 (E761K)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000114747]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000074171
AA Change: E746K

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372
AA Change: E746K

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114747
AA Change: E761K

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372
AA Change: E761K

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	269	367	3.76e-11	SMART
FerI	353	424	7.91e-38	SMART
C2	432	543	1.75e-11	SMART
low complexity region	622	633	N/A	INTRINSIC
FerB	856	932	5.13e-46	SMART
C2	975	1082	1.77e-7	SMART
Pfam:C2	1153	1236	1.8e-1	PFAM
low complexity region	1260	1271	N/A	INTRINSIC
low complexity region	1288	1318	N/A	INTRINSIC
low complexity region	1365	1380	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
C2	1488	1587	6.54e-11	SMART
C2	1728	1858	4.02e0	SMART
low complexity region	1903	1915	N/A	INTRINSIC
transmembrane domain	1959	1981	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000133509
AA Change: E761K

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000120591
Gene: ENSMUSG00000062372
AA Change: E761K

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	269	367	3.76e-11	SMART
FerI	353	424	7.91e-38	SMART
C2	432	543	1.75e-11	SMART
low complexity region	622	633	N/A	INTRINSIC
FerB	856	932	5.13e-46	SMART
C2	975	1082	1.77e-7	SMART
Pfam:C2	1153	1236	1.4e-2	PFAM
low complexity region	1260	1271	N/A	INTRINSIC
low complexity region	1288	1318	N/A	INTRINSIC
low complexity region	1365	1380	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
C2	1488	1587	6.54e-11	SMART
C2	1728	1858	4.02e0	SMART
low complexity region	1903	1915	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144125

SMART Domains

Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150734

Meta Mutation Damage Score

0.0961

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.5%

Validation Efficiency

94% (64/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930512M02Rik	A	T	11: 11,539,375 (GRCm39)		probably null	Het
Abtb2	G	T	2: 103,397,408 (GRCm39)	G113C	probably damaging	Het
Acsm5	A	G	7: 119,134,034 (GRCm39)	T272A	probably damaging	Het
Adprs	C	T	4: 126,211,102 (GRCm39)	E272K	possibly damaging	Het
Agbl5	G	A	5: 31,060,403 (GRCm39)	R141Q	probably damaging	Het
Atp7b	A	C	8: 22,518,472 (GRCm39)	I122S	possibly damaging	Het
B230219D22Rik	T	C	13: 55,847,288 (GRCm39)	Y134H	probably damaging	Het
Bnc1	A	G	7: 81,618,462 (GRCm39)	S868P	probably damaging	Het
Camta1	T	C	4: 151,229,926 (GRCm39)	E302G	probably damaging	Het
Car1	A	G	3: 14,835,933 (GRCm39)	Y129H	probably damaging	Het
Cdh22	T	C	2: 164,984,197 (GRCm39)	T352A	probably benign	Het
Ckmt2	T	C	13: 92,009,282 (GRCm39)	E215G	probably benign	Het
Cyb5r4	T	G	9: 86,941,130 (GRCm39)		probably null	Het
Dhrs13	A	G	11: 77,923,256 (GRCm39)		probably benign	Het
Dsg1c	G	A	18: 20,397,901 (GRCm39)	A34T	probably benign	Het
Epb41l1	T	C	2: 156,363,330 (GRCm39)	V613A	probably benign	Het
Fam114a1	A	G	5: 65,166,388 (GRCm39)	M240V	probably damaging	Het
Gm15455	T	C	1: 33,877,257 (GRCm39)		noncoding transcript	Het
Herc1	T	G	9: 66,383,742 (GRCm39)		probably benign	Het
Ifna11	T	C	4: 88,738,314 (GRCm39)	V40A	probably benign	Het
Ifna15	T	C	4: 88,476,266 (GRCm39)	N73D	probably benign	Het
Imp4	A	T	1: 34,482,016 (GRCm39)	L45F	probably damaging	Het
Jak3	G	A	8: 72,138,702 (GRCm39)	A967T	probably damaging	Het
Krtap19-2	A	T	16: 88,670,916 (GRCm39)	Y76*	probably null	Het
Map4k5	A	T	12: 69,871,388 (GRCm39)	N492K	probably damaging	Het
Mycbp2	C	T	14: 103,534,375 (GRCm39)	R372H	probably damaging	Het
Nos2	G	A	11: 78,813,140 (GRCm39)	S16N	probably benign	Het
Nr2c2	A	G	6: 92,116,803 (GRCm39)	T2A	probably damaging	Het
Nup188	T	C	2: 30,199,232 (GRCm39)	Y267H	probably damaging	Het
Nxph2	G	A	2: 23,211,556 (GRCm39)		probably null	Het
Or5b107	T	A	19: 13,142,955 (GRCm39)	D192E	probably benign	Het
Or5b96	T	A	19: 12,867,770 (GRCm39)	H57L	probably damaging	Het
Or9i1b	T	A	19: 13,896,822 (GRCm39)	V146E	possibly damaging	Het
Pik3r1	C	T	13: 101,825,952 (GRCm39)	R37Q	probably damaging	Het
Pkn3	T	C	2: 29,975,293 (GRCm39)		probably null	Het
Pold3	A	G	7: 99,770,590 (GRCm39)	V14A	probably damaging	Het
Ptpn14	T	C	1: 189,519,083 (GRCm39)	S38P	probably damaging	Het
Raf1	G	A	6: 115,597,196 (GRCm39)	Q35*	probably null	Het
Rps3a1	C	A	3: 86,045,338 (GRCm39)	E251D	probably benign	Het
Scd1	C	T	19: 44,390,148 (GRCm39)	V207M	probably damaging	Het
Shq1	A	G	6: 100,607,954 (GRCm39)	V319A	probably benign	Het
Slc4a8	T	C	15: 100,693,702 (GRCm39)	Y416H	probably damaging	Het
Slco1a5	T	C	6: 142,208,363 (GRCm39)	T143A	probably benign	Het
Slco1a5	C	T	6: 142,212,090 (GRCm39)	G90D	probably damaging	Het
Snx9	T	C	17: 5,937,348 (GRCm39)	V30A	probably benign	Het
Spdya	T	C	17: 71,895,561 (GRCm39)		probably benign	Het
Stat1	A	T	1: 52,162,368 (GRCm39)	N75I	probably damaging	Het
Sv2b	A	T	7: 74,807,173 (GRCm39)	M159K	probably damaging	Het
Tdh	A	T	14: 63,733,575 (GRCm39)	Y89*	probably null	Het
Tmc7	A	G	7: 118,142,588 (GRCm39)	F600S	probably damaging	Het
Trpa1	T	A	1: 14,981,090 (GRCm39)	H104L	probably damaging	Het
Ttn	G	A	2: 76,678,984 (GRCm39)		probably benign	Het
Vmn1r113	A	G	7: 20,521,419 (GRCm39)	I70M	possibly damaging	Het
Vmn1r171	A	G	7: 23,332,188 (GRCm39)	M138V	probably benign	Het
Zfc3h1	G	A	10: 115,240,116 (GRCm39)	V550I	probably benign	Het
Zfp335	G	T	2: 164,752,564 (GRCm39)	S60*	probably null	Het
Zfp7	T	C	15: 76,776,010 (GRCm39)	M684T	probably benign	Het
Zfp984	T	A	4: 147,839,903 (GRCm39)	H316L	probably damaging	Het
Zmym2	T	A	14: 57,193,637 (GRCm39)	Y1151N	possibly damaging	Het

Other mutations in Otof

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Otof	APN	5	30,533,248 (GRCm39)	missense	probably damaging	1.00
IGL00391:Otof	APN	5	30,532,967 (GRCm39)	missense	probably damaging	1.00
IGL00579:Otof	APN	5	30,556,666 (GRCm39)	missense	possibly damaging	0.88
IGL00671:Otof	APN	5	30,543,097 (GRCm39)	critical splice donor site	probably null
IGL01019:Otof	APN	5	30,562,560 (GRCm39)	missense	probably benign	0.01
IGL01025:Otof	APN	5	30,541,597 (GRCm39)	missense	possibly damaging	0.82
IGL01086:Otof	APN	5	30,533,617 (GRCm39)	critical splice donor site	probably null
IGL01110:Otof	APN	5	30,619,069 (GRCm39)	missense	probably damaging	1.00
IGL01160:Otof	APN	5	30,538,879 (GRCm39)	missense	probably benign	0.00
IGL01285:Otof	APN	5	30,562,527 (GRCm39)	missense	probably damaging	1.00
IGL01329:Otof	APN	5	30,598,723 (GRCm39)	missense	probably benign	0.00
IGL01337:Otof	APN	5	30,576,856 (GRCm39)	missense	probably benign	0.17
IGL01337:Otof	APN	5	30,563,121 (GRCm39)	missense	possibly damaging	0.93
IGL01834:Otof	APN	5	30,556,564 (GRCm39)	missense	probably damaging	1.00
IGL01872:Otof	APN	5	30,536,598 (GRCm39)	splice site	probably benign
IGL01969:Otof	APN	5	30,539,827 (GRCm39)	splice site	probably benign
IGL02075:Otof	APN	5	30,528,070 (GRCm39)	missense	probably benign	0.23
IGL02077:Otof	APN	5	30,556,579 (GRCm39)	missense	probably damaging	1.00
IGL02136:Otof	APN	5	30,531,336 (GRCm39)	missense	possibly damaging	0.90
IGL02227:Otof	APN	5	30,528,128 (GRCm39)	missense	probably damaging	1.00
IGL02475:Otof	APN	5	30,534,026 (GRCm39)	missense	probably damaging	1.00
IGL02812:Otof	APN	5	30,531,426 (GRCm39)	missense	probably benign	0.08
IGL02864:Otof	APN	5	30,543,685 (GRCm39)	missense	probably damaging	0.99
IGL03176:Otof	APN	5	30,562,520 (GRCm39)	splice site	probably null
R0285:Otof	UTSW	5	30,536,877 (GRCm39)	critical splice donor site	probably null
R0421:Otof	UTSW	5	30,528,912 (GRCm39)	missense	possibly damaging	0.94
R0570:Otof	UTSW	5	30,529,225 (GRCm39)	splice site	probably benign
R0599:Otof	UTSW	5	30,528,049 (GRCm39)	missense	probably damaging	1.00
R0675:Otof	UTSW	5	30,539,705 (GRCm39)	missense	probably benign	0.01
R0715:Otof	UTSW	5	30,552,041 (GRCm39)	missense	probably damaging	0.99
R1019:Otof	UTSW	5	30,528,087 (GRCm39)	missense	probably damaging	0.96
R1183:Otof	UTSW	5	30,529,256 (GRCm39)	missense	probably damaging	1.00
R1435:Otof	UTSW	5	30,536,039 (GRCm39)	missense	probably benign	0.00
R1469:Otof	UTSW	5	30,537,571 (GRCm39)	missense	probably benign	0.00
R1469:Otof	UTSW	5	30,537,571 (GRCm39)	missense	probably benign	0.00
R1474:Otof	UTSW	5	30,536,876 (GRCm39)	critical splice donor site	probably null
R1524:Otof	UTSW	5	30,536,900 (GRCm39)	missense	probably benign	0.03
R1563:Otof	UTSW	5	30,528,349 (GRCm39)	missense	probably benign	0.00
R1732:Otof	UTSW	5	30,543,815 (GRCm39)	missense	probably damaging	1.00
R1822:Otof	UTSW	5	30,536,054 (GRCm39)	missense	probably benign	0.00
R1845:Otof	UTSW	5	30,529,067 (GRCm39)	nonsense	probably null
R1925:Otof	UTSW	5	30,551,532 (GRCm39)	missense	probably benign	0.37
R1938:Otof	UTSW	5	30,533,713 (GRCm39)	missense	probably benign	0.00
R1968:Otof	UTSW	5	30,545,998 (GRCm39)	missense	probably damaging	1.00
R1996:Otof	UTSW	5	30,578,381 (GRCm39)	missense	probably benign	0.01
R1999:Otof	UTSW	5	30,546,116 (GRCm39)	missense	probably benign	0.19
R2027:Otof	UTSW	5	30,578,358 (GRCm39)	missense	probably benign	0.08
R2138:Otof	UTSW	5	30,619,114 (GRCm39)	missense	probably benign	0.01
R2173:Otof	UTSW	5	30,543,718 (GRCm39)	missense	probably damaging	1.00
R2245:Otof	UTSW	5	30,527,551 (GRCm39)	missense	probably damaging	1.00
R3011:Otof	UTSW	5	30,540,184 (GRCm39)	missense	probably damaging	1.00
R3105:Otof	UTSW	5	30,539,145 (GRCm39)	missense	probably benign	0.03
R3442:Otof	UTSW	5	30,529,033 (GRCm39)	missense	probably damaging	1.00
R3710:Otof	UTSW	5	30,542,610 (GRCm39)	missense	probably benign
R3715:Otof	UTSW	5	30,534,215 (GRCm39)	nonsense	probably null
R3806:Otof	UTSW	5	30,543,843 (GRCm39)	critical splice acceptor site	probably null
R3975:Otof	UTSW	5	30,528,056 (GRCm39)	missense	probably damaging	1.00
R4067:Otof	UTSW	5	30,556,635 (GRCm39)	missense	probably damaging	1.00
R4077:Otof	UTSW	5	30,576,850 (GRCm39)	missense	possibly damaging	0.89
R4166:Otof	UTSW	5	30,539,762 (GRCm39)	missense	probably damaging	1.00
R4451:Otof	UTSW	5	30,542,508 (GRCm39)	missense	possibly damaging	0.77
R4485:Otof	UTSW	5	30,532,344 (GRCm39)	missense	possibly damaging	0.77
R4600:Otof	UTSW	5	30,529,244 (GRCm39)	missense	probably damaging	1.00
R4646:Otof	UTSW	5	30,540,914 (GRCm39)	missense	possibly damaging	0.82
R4648:Otof	UTSW	5	30,540,914 (GRCm39)	missense	possibly damaging	0.82
R4669:Otof	UTSW	5	30,578,318 (GRCm39)	critical splice donor site	probably null
R4773:Otof	UTSW	5	30,552,026 (GRCm39)	missense	probably benign	0.05
R4839:Otof	UTSW	5	30,576,748 (GRCm39)	missense	probably damaging	0.99
R4907:Otof	UTSW	5	30,536,005 (GRCm39)	critical splice donor site	probably null
R4961:Otof	UTSW	5	30,540,837 (GRCm39)	intron	probably benign
R4991:Otof	UTSW	5	30,551,525 (GRCm39)	missense	probably damaging	1.00
R5015:Otof	UTSW	5	30,540,238 (GRCm39)	missense	probably damaging	1.00
R5036:Otof	UTSW	5	30,541,783 (GRCm39)	missense	possibly damaging	0.54
R5253:Otof	UTSW	5	30,527,483 (GRCm39)	missense	probably damaging	1.00
R5336:Otof	UTSW	5	30,534,064 (GRCm39)	missense	probably benign	0.01
R5365:Otof	UTSW	5	30,539,144 (GRCm39)	missense	probably damaging	0.99
R5901:Otof	UTSW	5	30,532,323 (GRCm39)	missense	probably damaging	1.00
R6211:Otof	UTSW	5	30,529,244 (GRCm39)	missense	probably damaging	0.99
R6318:Otof	UTSW	5	30,571,888 (GRCm39)	missense	probably damaging	1.00
R6331:Otof	UTSW	5	30,529,279 (GRCm39)	missense	possibly damaging	0.94
R6671:Otof	UTSW	5	30,576,877 (GRCm39)	missense	probably benign
R6701:Otof	UTSW	5	30,528,141 (GRCm39)	nonsense	probably null
R6792:Otof	UTSW	5	30,532,978 (GRCm39)	missense	probably damaging	1.00
R6853:Otof	UTSW	5	30,545,583 (GRCm39)	missense	probably damaging	1.00
R6940:Otof	UTSW	5	30,528,987 (GRCm39)	missense	probably damaging	0.96
R7037:Otof	UTSW	5	30,538,882 (GRCm39)	missense	probably benign	0.32
R7060:Otof	UTSW	5	30,545,700 (GRCm39)	missense	possibly damaging	0.84
R7089:Otof	UTSW	5	30,528,912 (GRCm39)	missense	possibly damaging	0.94
R7165:Otof	UTSW	5	30,532,964 (GRCm39)	missense	probably damaging	0.99
R7178:Otof	UTSW	5	30,540,878 (GRCm39)	missense	possibly damaging	0.50
R7298:Otof	UTSW	5	30,545,614 (GRCm39)	missense	probably damaging	1.00
R7393:Otof	UTSW	5	30,527,614 (GRCm39)	missense	probably benign	0.45
R7397:Otof	UTSW	5	30,533,051 (GRCm39)	missense	probably damaging	1.00
R7400:Otof	UTSW	5	30,542,532 (GRCm39)	missense	probably benign	0.04
R7428:Otof	UTSW	5	30,547,169 (GRCm39)	missense	probably damaging	1.00
R7456:Otof	UTSW	5	30,552,005 (GRCm39)	missense	probably damaging	1.00
R7505:Otof	UTSW	5	30,528,364 (GRCm39)	missense	probably benign	0.00
R7714:Otof	UTSW	5	30,527,597 (GRCm39)	missense	probably damaging	0.99
R8002:Otof	UTSW	5	30,537,954 (GRCm39)	missense	probably benign	0.10
R8032:Otof	UTSW	5	30,619,142 (GRCm39)	start codon destroyed	probably benign	0.07
R8153:Otof	UTSW	5	30,546,079 (GRCm39)	missense	probably damaging	1.00
R8158:Otof	UTSW	5	30,537,538 (GRCm39)	missense	probably benign	0.37
R8159:Otof	UTSW	5	30,537,538 (GRCm39)	missense	probably benign	0.37
R8441:Otof	UTSW	5	30,538,200 (GRCm39)	missense	probably damaging	0.99
R8738:Otof	UTSW	5	30,545,968 (GRCm39)	nonsense	probably null
R8813:Otof	UTSW	5	30,540,242 (GRCm39)	missense	probably benign	0.02
R8835:Otof	UTSW	5	30,528,264 (GRCm39)	missense	probably benign	0.44
R8852:Otof	UTSW	5	30,529,044 (GRCm39)	missense	possibly damaging	0.94
R8869:Otof	UTSW	5	30,578,325 (GRCm39)	missense	probably benign	0.08
R9029:Otof	UTSW	5	30,527,419 (GRCm39)	critical splice donor site	probably null
R9031:Otof	UTSW	5	30,537,532 (GRCm39)	missense	probably benign
R9061:Otof	UTSW	5	30,546,001 (GRCm39)	missense	possibly damaging	0.50
R9100:Otof	UTSW	5	30,539,696 (GRCm39)	missense	possibly damaging	0.80
R9121:Otof	UTSW	5	30,536,462 (GRCm39)	missense	probably benign	0.04
R9188:Otof	UTSW	5	30,534,095 (GRCm39)	missense	probably damaging	1.00
R9218:Otof	UTSW	5	30,542,469 (GRCm39)	missense	probably benign
R9280:Otof	UTSW	5	30,528,894 (GRCm39)	missense	probably damaging	0.98
R9395:Otof	UTSW	5	30,532,976 (GRCm39)	missense	probably damaging	1.00
R9400:Otof	UTSW	5	30,540,863 (GRCm39)	critical splice donor site	probably null
R9407:Otof	UTSW	5	30,538,265 (GRCm39)	missense	probably damaging	1.00
R9616:Otof	UTSW	5	30,539,708 (GRCm39)	missense	possibly damaging	0.95
R9665:Otof	UTSW	5	30,584,895 (GRCm39)	missense	probably benign	0.22
R9748:Otof	UTSW	5	30,540,998 (GRCm39)	missense	probably damaging	1.00
R9783:Otof	UTSW	5	30,536,576 (GRCm39)	missense	probably benign
Z1176:Otof	UTSW	5	30,528,930 (GRCm39)	missense	probably damaging	0.98
Z1177:Otof	UTSW	5	30,541,002 (GRCm39)	missense	probably damaging	1.00
Z1177:Otof	UTSW	5	30,533,641 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACTTAAGACGCTCTCGATCC -3'
(R):5'- AGTCCCCGTGTCTACAACTG -3'

Sequencing Primer
(F):5'- TCTCGATCCAGCCTGGTG -3'
(R):5'- CGTGTCTACAACTGGGGAG -3'

Posted On

2016-06-15