Incidental Mutation 'R5038:Otof'
ID393102
Institutional Source Beutler Lab
Gene Symbol Otof
Ensembl Gene ENSMUSG00000062372
Gene Nameotoferlin
Synonyms
MMRRC Submission 042628-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R5038 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location30367062-30461932 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30384439 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 761 (E761K)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000114747]
Predicted Effect probably benign
Transcript: ENSMUST00000074171
AA Change: E746K

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372
AA Change: E746K

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114747
AA Change: E761K

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372
AA Change: E761K

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 269 367 3.76e-11 SMART
FerI 353 424 7.91e-38 SMART
C2 432 543 1.75e-11 SMART
low complexity region 622 633 N/A INTRINSIC
FerB 856 932 5.13e-46 SMART
C2 975 1082 1.77e-7 SMART
Pfam:C2 1153 1236 1.8e-1 PFAM
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1288 1318 N/A INTRINSIC
low complexity region 1365 1380 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
C2 1488 1587 6.54e-11 SMART
C2 1728 1858 4.02e0 SMART
low complexity region 1903 1915 N/A INTRINSIC
transmembrane domain 1959 1981 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000133509
AA Change: E761K

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120591
Gene: ENSMUSG00000062372
AA Change: E761K

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 269 367 3.76e-11 SMART
FerI 353 424 7.91e-38 SMART
C2 432 543 1.75e-11 SMART
low complexity region 622 633 N/A INTRINSIC
FerB 856 932 5.13e-46 SMART
C2 975 1082 1.77e-7 SMART
Pfam:C2 1153 1236 1.4e-2 PFAM
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1288 1318 N/A INTRINSIC
low complexity region 1365 1380 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
C2 1488 1587 6.54e-11 SMART
C2 1728 1858 4.02e0 SMART
low complexity region 1903 1915 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144125
SMART Domains Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150734
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 94% (64/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930512M02Rik A T 11: 11,589,375 probably null Het
Abtb2 G T 2: 103,567,063 G113C probably damaging Het
Acsm5 A G 7: 119,534,811 T272A probably damaging Het
Adprhl2 C T 4: 126,317,309 E272K possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Atp7b A C 8: 22,028,456 I122S possibly damaging Het
B230219D22Rik T C 13: 55,699,475 Y134H probably damaging Het
Bnc1 A G 7: 81,968,714 S868P probably damaging Het
Camta1 T C 4: 151,145,469 E302G probably damaging Het
Car1 A G 3: 14,770,873 Y129H probably damaging Het
Cdh22 T C 2: 165,142,277 T352A probably benign Het
Ckmt2 T C 13: 91,861,163 E215G probably benign Het
Cyb5r4 T G 9: 87,059,077 probably null Het
Dhrs13 A G 11: 78,032,430 probably benign Het
Dsg1c G A 18: 20,264,844 A34T probably benign Het
Epb41l1 T C 2: 156,521,410 V613A probably benign Het
Fam114a1 A G 5: 65,009,045 M240V probably damaging Het
Gm15455 T C 1: 33,838,176 noncoding transcript Het
Herc1 T G 9: 66,476,460 probably benign Het
Ifna11 T C 4: 88,820,077 V40A probably benign Het
Ifna15 T C 4: 88,558,029 N73D probably benign Het
Imp4 A T 1: 34,442,935 L45F probably damaging Het
Jak3 G A 8: 71,686,058 A967T probably damaging Het
Krtap19-2 A T 16: 88,874,028 Y76* probably null Het
Map4k5 A T 12: 69,824,614 N492K probably damaging Het
Mycbp2 C T 14: 103,296,939 R372H probably damaging Het
Nos2 G A 11: 78,922,314 S16N probably benign Het
Nr2c2 A G 6: 92,139,822 T2A probably damaging Het
Nup188 T C 2: 30,309,220 Y267H probably damaging Het
Nxph2 G A 2: 23,321,544 probably null Het
Olfr1446 T A 19: 12,890,406 H57L probably damaging Het
Olfr1461 T A 19: 13,165,591 D192E probably benign Het
Olfr1505 T A 19: 13,919,458 V146E possibly damaging Het
Pik3r1 C T 13: 101,689,444 R37Q probably damaging Het
Pkn3 T C 2: 30,085,281 probably null Het
Pold3 A G 7: 100,121,383 V14A probably damaging Het
Ptpn14 T C 1: 189,786,886 S38P probably damaging Het
Raf1 G A 6: 115,620,235 Q35* probably null Het
Rps3a1 C A 3: 86,138,031 E251D probably benign Het
Scd1 C T 19: 44,401,709 V207M probably damaging Het
Shq1 A G 6: 100,630,993 V319A probably benign Het
Slc4a8 T C 15: 100,795,821 Y416H probably damaging Het
Slco1a5 T C 6: 142,262,637 T143A probably benign Het
Slco1a5 C T 6: 142,266,364 G90D probably damaging Het
Snx9 T C 17: 5,887,073 V30A probably benign Het
Spdya T C 17: 71,588,566 probably benign Het
Stat1 A T 1: 52,123,209 N75I probably damaging Het
Sv2b A T 7: 75,157,425 M159K probably damaging Het
Tdh A T 14: 63,496,126 Y89* probably null Het
Tmc7 A G 7: 118,543,365 F600S probably damaging Het
Trpa1 T A 1: 14,910,866 H104L probably damaging Het
Ttn G A 2: 76,848,640 probably benign Het
Vmn1r113 A G 7: 20,787,494 I70M possibly damaging Het
Vmn1r171 A G 7: 23,632,763 M138V probably benign Het
Zfc3h1 G A 10: 115,404,211 V550I probably benign Het
Zfp335 G T 2: 164,910,644 S60* probably null Het
Zfp7 T C 15: 76,891,810 M684T probably benign Het
Zfp984 T A 4: 147,755,446 H316L probably damaging Het
Zmym2 T A 14: 56,956,180 Y1151N possibly damaging Het
Other mutations in Otof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Otof APN 5 30375904 missense probably damaging 1.00
IGL00391:Otof APN 5 30375623 missense probably damaging 1.00
IGL00579:Otof APN 5 30399322 missense possibly damaging 0.88
IGL00671:Otof APN 5 30385753 critical splice donor site probably null
IGL01019:Otof APN 5 30405216 missense probably benign 0.01
IGL01025:Otof APN 5 30384253 missense possibly damaging 0.82
IGL01086:Otof APN 5 30376273 critical splice donor site probably null
IGL01110:Otof APN 5 30461725 missense probably damaging 1.00
IGL01160:Otof APN 5 30381535 missense probably benign 0.00
IGL01285:Otof APN 5 30405183 missense probably damaging 1.00
IGL01329:Otof APN 5 30441379 missense probably benign 0.00
IGL01337:Otof APN 5 30405777 missense possibly damaging 0.93
IGL01337:Otof APN 5 30419512 missense probably benign 0.17
IGL01834:Otof APN 5 30399220 missense probably damaging 1.00
IGL01872:Otof APN 5 30379254 splice site probably benign
IGL01969:Otof APN 5 30382483 splice site probably benign
IGL02075:Otof APN 5 30370726 missense probably benign 0.23
IGL02077:Otof APN 5 30399235 missense probably damaging 1.00
IGL02136:Otof APN 5 30373992 missense possibly damaging 0.90
IGL02227:Otof APN 5 30370784 missense probably damaging 1.00
IGL02475:Otof APN 5 30376682 missense probably damaging 1.00
IGL02812:Otof APN 5 30374082 missense probably benign 0.08
IGL02864:Otof APN 5 30386341 missense probably damaging 0.99
IGL03176:Otof APN 5 30405176 splice site probably null
R0285:Otof UTSW 5 30379533 critical splice donor site probably null
R0421:Otof UTSW 5 30371568 missense possibly damaging 0.94
R0570:Otof UTSW 5 30371881 splice site probably benign
R0599:Otof UTSW 5 30370705 missense probably damaging 1.00
R0675:Otof UTSW 5 30382361 missense probably benign 0.01
R0715:Otof UTSW 5 30394697 missense probably damaging 0.99
R1019:Otof UTSW 5 30370743 missense probably damaging 0.96
R1183:Otof UTSW 5 30371912 missense probably damaging 1.00
R1435:Otof UTSW 5 30378695 missense probably benign 0.00
R1469:Otof UTSW 5 30380227 missense probably benign 0.00
R1469:Otof UTSW 5 30380227 missense probably benign 0.00
R1474:Otof UTSW 5 30379532 critical splice donor site probably null
R1524:Otof UTSW 5 30379556 missense probably benign 0.03
R1563:Otof UTSW 5 30371005 missense probably benign 0.00
R1732:Otof UTSW 5 30386471 missense probably damaging 1.00
R1822:Otof UTSW 5 30378710 missense probably benign 0.00
R1845:Otof UTSW 5 30371723 nonsense probably null
R1925:Otof UTSW 5 30394188 missense probably benign 0.37
R1938:Otof UTSW 5 30376369 missense probably benign 0.00
R1968:Otof UTSW 5 30388654 missense probably damaging 1.00
R1996:Otof UTSW 5 30421037 missense probably benign 0.01
R1999:Otof UTSW 5 30388772 missense probably benign 0.19
R2027:Otof UTSW 5 30421014 missense probably benign 0.08
R2138:Otof UTSW 5 30461770 missense probably benign 0.01
R2173:Otof UTSW 5 30386374 missense probably damaging 1.00
R2245:Otof UTSW 5 30370207 missense probably damaging 1.00
R3011:Otof UTSW 5 30382840 missense probably damaging 1.00
R3105:Otof UTSW 5 30381801 missense probably benign 0.03
R3442:Otof UTSW 5 30371689 missense probably damaging 1.00
R3710:Otof UTSW 5 30385266 missense probably benign
R3715:Otof UTSW 5 30376871 nonsense probably null
R3806:Otof UTSW 5 30386499 critical splice acceptor site probably null
R3975:Otof UTSW 5 30370712 missense probably damaging 1.00
R4067:Otof UTSW 5 30399291 missense probably damaging 1.00
R4077:Otof UTSW 5 30419506 missense possibly damaging 0.89
R4166:Otof UTSW 5 30382418 missense probably damaging 1.00
R4451:Otof UTSW 5 30385164 missense possibly damaging 0.77
R4485:Otof UTSW 5 30375000 missense possibly damaging 0.77
R4600:Otof UTSW 5 30371900 missense probably damaging 1.00
R4646:Otof UTSW 5 30383570 missense possibly damaging 0.82
R4648:Otof UTSW 5 30383570 missense possibly damaging 0.82
R4669:Otof UTSW 5 30420974 critical splice donor site probably null
R4773:Otof UTSW 5 30394682 missense probably benign 0.05
R4839:Otof UTSW 5 30419404 missense probably damaging 0.99
R4907:Otof UTSW 5 30378661 critical splice donor site probably null
R4961:Otof UTSW 5 30383493 intron probably benign
R4991:Otof UTSW 5 30394181 missense probably damaging 1.00
R5015:Otof UTSW 5 30382894 missense probably damaging 1.00
R5036:Otof UTSW 5 30384439 missense possibly damaging 0.54
R5253:Otof UTSW 5 30370139 missense probably damaging 1.00
R5336:Otof UTSW 5 30376720 missense probably benign 0.01
R5365:Otof UTSW 5 30381800 missense probably damaging 0.99
R5901:Otof UTSW 5 30374979 missense probably damaging 1.00
R6211:Otof UTSW 5 30371900 missense probably damaging 0.99
R6318:Otof UTSW 5 30414544 missense probably damaging 1.00
R6331:Otof UTSW 5 30371935 missense possibly damaging 0.94
R6671:Otof UTSW 5 30419533 missense probably benign
R6701:Otof UTSW 5 30370797 nonsense probably null
R6792:Otof UTSW 5 30375634 missense probably damaging 1.00
R6853:Otof UTSW 5 30388239 missense probably damaging 1.00
R6940:Otof UTSW 5 30371643 missense probably damaging 0.96
R7037:Otof UTSW 5 30381538 missense probably benign 0.32
R7060:Otof UTSW 5 30388356 missense possibly damaging 0.84
R7089:Otof UTSW 5 30371568 missense possibly damaging 0.94
R7165:Otof UTSW 5 30375620 missense probably damaging 0.99
R7178:Otof UTSW 5 30383534 missense possibly damaging 0.50
R7298:Otof UTSW 5 30388270 missense probably damaging 1.00
R7393:Otof UTSW 5 30370270 missense probably benign 0.45
R7397:Otof UTSW 5 30375707 missense probably damaging 1.00
R7400:Otof UTSW 5 30385188 missense probably benign 0.04
R7428:Otof UTSW 5 30389825 missense probably damaging 1.00
R7456:Otof UTSW 5 30394661 missense probably damaging 1.00
R7505:Otof UTSW 5 30371020 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACTTAAGACGCTCTCGATCC -3'
(R):5'- AGTCCCCGTGTCTACAACTG -3'

Sequencing Primer
(F):5'- TCTCGATCCAGCCTGGTG -3'
(R):5'- CGTGTCTACAACTGGGGAG -3'
Posted On2016-06-15