Incidental Mutation 'R5038:Nr2c2'
ID393105
Institutional Source Beutler Lab
Gene Symbol Nr2c2
Ensembl Gene ENSMUSG00000005893
Gene Namenuclear receptor subfamily 2, group C, member 2
SynonymsTAK1, Tr4
MMRRC Submission 042628-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.582) question?
Stock #R5038 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location92091390-92174294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92139822 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 2 (T2A)
Ref Sequence ENSEMBL: ENSMUSP00000145094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113460] [ENSMUST00000113463] [ENSMUST00000133133] [ENSMUST00000146175]
Predicted Effect probably benign
Transcript: ENSMUST00000113460
AA Change: T2A

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000109087
Gene: ENSMUSG00000005893
AA Change: T2A

DomainStartEndE-ValueType
ZnF_C4 114 185 4.33e-40 SMART
Blast:HOLI 238 324 4e-46 BLAST
HOLI 388 554 1.9e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113463
AA Change: T35A

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000109090
Gene: ENSMUSG00000005893
AA Change: T35A

DomainStartEndE-ValueType
ZnF_C4 147 218 4.33e-40 SMART
Blast:HOLI 271 357 6e-46 BLAST
HOLI 421 587 1.9e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133133
AA Change: T2A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000146175
AA Change: T2A

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000138465
Gene: ENSMUSG00000005893
AA Change: T2A

DomainStartEndE-ValueType
ZnF_C4 114 185 4.33e-40 SMART
Blast:HOLI 238 324 7e-47 BLAST
Pfam:Hormone_recep 367 493 8.8e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204661
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 94% (64/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the nuclear hormone receptor family. Members of this family act as ligand-activated transcription factors and function in many biological processes such as development, cellular differentiation and homeostasis. The activated receptor/ligand complex is translocated to the nucleus where it binds to hormone response elements of target genes. The protein encoded by this gene plays a role in protecting cells from oxidative stress and damage induced by ionizing radiation. The lack of a similar gene in mouse results in growth retardation, severe spinal curvature, subfertility, premature aging, and prostatic intraepithelial neoplasia (PIN) development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice display reduced body size, reduced male fertility, and impaired spermatogenesis. Mice homozygous for a conditional allele activated in the CNS exhibit increased thermal, mechanical and chemical nociception threshold, decreased pruritus and neuronal loss in the spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930512M02Rik A T 11: 11,589,375 probably null Het
Abtb2 G T 2: 103,567,063 G113C probably damaging Het
Acsm5 A G 7: 119,534,811 T272A probably damaging Het
Adprhl2 C T 4: 126,317,309 E272K possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Atp7b A C 8: 22,028,456 I122S possibly damaging Het
B230219D22Rik T C 13: 55,699,475 Y134H probably damaging Het
Bnc1 A G 7: 81,968,714 S868P probably damaging Het
Camta1 T C 4: 151,145,469 E302G probably damaging Het
Car1 A G 3: 14,770,873 Y129H probably damaging Het
Cdh22 T C 2: 165,142,277 T352A probably benign Het
Ckmt2 T C 13: 91,861,163 E215G probably benign Het
Cyb5r4 T G 9: 87,059,077 probably null Het
Dhrs13 A G 11: 78,032,430 probably benign Het
Dsg1c G A 18: 20,264,844 A34T probably benign Het
Epb41l1 T C 2: 156,521,410 V613A probably benign Het
Fam114a1 A G 5: 65,009,045 M240V probably damaging Het
Gm15455 T C 1: 33,838,176 noncoding transcript Het
Herc1 T G 9: 66,476,460 probably benign Het
Ifna11 T C 4: 88,820,077 V40A probably benign Het
Ifna15 T C 4: 88,558,029 N73D probably benign Het
Imp4 A T 1: 34,442,935 L45F probably damaging Het
Jak3 G A 8: 71,686,058 A967T probably damaging Het
Krtap19-2 A T 16: 88,874,028 Y76* probably null Het
Map4k5 A T 12: 69,824,614 N492K probably damaging Het
Mycbp2 C T 14: 103,296,939 R372H probably damaging Het
Nos2 G A 11: 78,922,314 S16N probably benign Het
Nup188 T C 2: 30,309,220 Y267H probably damaging Het
Nxph2 G A 2: 23,321,544 probably null Het
Olfr1446 T A 19: 12,890,406 H57L probably damaging Het
Olfr1461 T A 19: 13,165,591 D192E probably benign Het
Olfr1505 T A 19: 13,919,458 V146E possibly damaging Het
Otof C T 5: 30,384,439 E761K possibly damaging Het
Pik3r1 C T 13: 101,689,444 R37Q probably damaging Het
Pkn3 T C 2: 30,085,281 probably null Het
Pold3 A G 7: 100,121,383 V14A probably damaging Het
Ptpn14 T C 1: 189,786,886 S38P probably damaging Het
Raf1 G A 6: 115,620,235 Q35* probably null Het
Rps3a1 C A 3: 86,138,031 E251D probably benign Het
Scd1 C T 19: 44,401,709 V207M probably damaging Het
Shq1 A G 6: 100,630,993 V319A probably benign Het
Slc4a8 T C 15: 100,795,821 Y416H probably damaging Het
Slco1a5 T C 6: 142,262,637 T143A probably benign Het
Slco1a5 C T 6: 142,266,364 G90D probably damaging Het
Snx9 T C 17: 5,887,073 V30A probably benign Het
Spdya T C 17: 71,588,566 probably benign Het
Stat1 A T 1: 52,123,209 N75I probably damaging Het
Sv2b A T 7: 75,157,425 M159K probably damaging Het
Tdh A T 14: 63,496,126 Y89* probably null Het
Tmc7 A G 7: 118,543,365 F600S probably damaging Het
Trpa1 T A 1: 14,910,866 H104L probably damaging Het
Ttn G A 2: 76,848,640 probably benign Het
Vmn1r113 A G 7: 20,787,494 I70M possibly damaging Het
Vmn1r171 A G 7: 23,632,763 M138V probably benign Het
Zfc3h1 G A 10: 115,404,211 V550I probably benign Het
Zfp335 G T 2: 164,910,644 S60* probably null Het
Zfp7 T C 15: 76,891,810 M684T probably benign Het
Zfp984 T A 4: 147,755,446 H316L probably damaging Het
Zmym2 T A 14: 56,956,180 Y1151N possibly damaging Het
Other mutations in Nr2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Nr2c2 APN 6 92149719 missense probably damaging 1.00
IGL01129:Nr2c2 APN 6 92158416 missense probably benign 0.08
IGL01578:Nr2c2 APN 6 92162038 missense probably benign 0.01
IGL02281:Nr2c2 APN 6 92154514 missense probably benign 0.20
R1385:Nr2c2 UTSW 6 92154470 missense probably damaging 1.00
R1397:Nr2c2 UTSW 6 92149764 missense probably benign 0.34
R1503:Nr2c2 UTSW 6 92105331 missense probably benign
R1691:Nr2c2 UTSW 6 92156692 missense probably damaging 0.99
R1779:Nr2c2 UTSW 6 92159243 missense possibly damaging 0.50
R2655:Nr2c2 UTSW 6 92163138 missense probably damaging 0.99
R3840:Nr2c2 UTSW 6 92163138 missense probably damaging 0.99
R3841:Nr2c2 UTSW 6 92163138 missense probably damaging 0.99
R3923:Nr2c2 UTSW 6 92160401 missense probably damaging 0.98
R3926:Nr2c2 UTSW 6 92160401 missense probably damaging 0.98
R3945:Nr2c2 UTSW 6 92163138 missense probably damaging 0.99
R3946:Nr2c2 UTSW 6 92163138 missense probably damaging 0.99
R4721:Nr2c2 UTSW 6 92139847 missense possibly damaging 0.49
R5101:Nr2c2 UTSW 6 92154516 critical splice donor site probably null
R5524:Nr2c2 UTSW 6 92139765 splice site probably null
R6884:Nr2c2 UTSW 6 92158393 missense probably benign 0.05
R7046:Nr2c2 UTSW 6 92158357 missense probably damaging 1.00
R7278:Nr2c2 UTSW 6 92159378 missense probably damaging 0.96
R7316:Nr2c2 UTSW 6 92154463 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCAAGGACACAGCAAGAGC -3'
(R):5'- TGAGCTCACACTGTACTTGATGTC -3'

Sequencing Primer
(F):5'- CAGGCTGGAGTTTATAAGACCTTTCC -3'
(R):5'- TTACCTGAATGCGCTGAG -3'
Posted On2016-06-15