Mutagenetix > Incidental Mutations

Incidental Mutation 'R5038:Dsg1c'

393136

Institutional Source

Beutler Lab

Gene Symbol

Dsg1c

Ensembl Gene

ENSMUSG00000034774

Gene Name

desmoglein 1 gamma

Synonyms

Dsg6

MMRRC Submission

042628-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5038 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20247340-20285031 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 20264844 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 34 (A34T)

Ref Sequence

ENSEMBL: ENSMUSP00000054799 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054128]

Predicted Effect

probably benign
Transcript: ENSMUST00000054128
AA Change: A34T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000054799
Gene: ENSMUSG00000034774
AA Change: A34T

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	70	155	1.7e-16	SMART
CA	179	267	5.2e-24	SMART
CA	290	384	4.5e-8	SMART
Blast:CA	407	488	8e-28	BLAST
low complexity region	491	500	N/A	INTRINSIC
low complexity region	528	539	N/A	INTRINSIC
low complexity region	545	553	N/A	INTRINSIC
Pfam:Cadherin_C	611	732	5.2e-8	PFAM
low complexity region	737	750	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.5%

Validation Efficiency

94% (64/68)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930512M02Rik	A	T	11: 11,589,375		probably null	Het
Abtb2	G	T	2: 103,567,063	G113C	probably damaging	Het
Acsm5	A	G	7: 119,534,811	T272A	probably damaging	Het
Adprhl2	C	T	4: 126,317,309	E272K	possibly damaging	Het
Agbl5	G	A	5: 30,903,059	R141Q	probably damaging	Het
Atp7b	A	C	8: 22,028,456	I122S	possibly damaging	Het
B230219D22Rik	T	C	13: 55,699,475	Y134H	probably damaging	Het
Bnc1	A	G	7: 81,968,714	S868P	probably damaging	Het
Camta1	T	C	4: 151,145,469	E302G	probably damaging	Het
Car1	A	G	3: 14,770,873	Y129H	probably damaging	Het
Cdh22	T	C	2: 165,142,277	T352A	probably benign	Het
Ckmt2	T	C	13: 91,861,163	E215G	probably benign	Het
Cyb5r4	T	G	9: 87,059,077		probably null	Het
Dhrs13	A	G	11: 78,032,430		probably benign	Het
Epb41l1	T	C	2: 156,521,410	V613A	probably benign	Het
Fam114a1	A	G	5: 65,009,045	M240V	probably damaging	Het
Gm15455	T	C	1: 33,838,176		noncoding transcript	Het
Herc1	T	G	9: 66,476,460		probably benign	Het
Ifna11	T	C	4: 88,820,077	V40A	probably benign	Het
Ifna15	T	C	4: 88,558,029	N73D	probably benign	Het
Imp4	A	T	1: 34,442,935	L45F	probably damaging	Het
Jak3	G	A	8: 71,686,058	A967T	probably damaging	Het
Krtap19-2	A	T	16: 88,874,028	Y76*	probably null	Het
Map4k5	A	T	12: 69,824,614	N492K	probably damaging	Het
Mycbp2	C	T	14: 103,296,939	R372H	probably damaging	Het
Nos2	G	A	11: 78,922,314	S16N	probably benign	Het
Nr2c2	A	G	6: 92,139,822	T2A	probably damaging	Het
Nup188	T	C	2: 30,309,220	Y267H	probably damaging	Het
Nxph2	G	A	2: 23,321,544		probably null	Het
Olfr1446	T	A	19: 12,890,406	H57L	probably damaging	Het
Olfr1461	T	A	19: 13,165,591	D192E	probably benign	Het
Olfr1505	T	A	19: 13,919,458	V146E	possibly damaging	Het
Otof	C	T	5: 30,384,439	E761K	possibly damaging	Het
Pik3r1	C	T	13: 101,689,444	R37Q	probably damaging	Het
Pkn3	T	C	2: 30,085,281		probably null	Het
Pold3	A	G	7: 100,121,383	V14A	probably damaging	Het
Ptpn14	T	C	1: 189,786,886	S38P	probably damaging	Het
Raf1	G	A	6: 115,620,235	Q35*	probably null	Het
Rps3a1	C	A	3: 86,138,031	E251D	probably benign	Het
Scd1	C	T	19: 44,401,709	V207M	probably damaging	Het
Shq1	A	G	6: 100,630,993	V319A	probably benign	Het
Slc4a8	T	C	15: 100,795,821	Y416H	probably damaging	Het
Slco1a5	T	C	6: 142,262,637	T143A	probably benign	Het
Slco1a5	C	T	6: 142,266,364	G90D	probably damaging	Het
Snx9	T	C	17: 5,887,073	V30A	probably benign	Het
Spdya	T	C	17: 71,588,566		probably benign	Het
Stat1	A	T	1: 52,123,209	N75I	probably damaging	Het
Sv2b	A	T	7: 75,157,425	M159K	probably damaging	Het
Tdh	A	T	14: 63,496,126	Y89*	probably null	Het
Tmc7	A	G	7: 118,543,365	F600S	probably damaging	Het
Trpa1	T	A	1: 14,910,866	H104L	probably damaging	Het
Ttn	G	A	2: 76,848,640		probably benign	Het
Vmn1r113	A	G	7: 20,787,494	I70M	possibly damaging	Het
Vmn1r171	A	G	7: 23,632,763	M138V	probably benign	Het
Zfc3h1	G	A	10: 115,404,211	V550I	probably benign	Het
Zfp335	G	T	2: 164,910,644	S60*	probably null	Het
Zfp7	T	C	15: 76,891,810	M684T	probably benign	Het
Zfp984	T	A	4: 147,755,446	H316L	probably damaging	Het
Zmym2	T	A	14: 56,956,180	Y1151N	possibly damaging	Het

Other mutations in Dsg1c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00567:Dsg1c	APN	18	20274676	missense	probably damaging	1.00
IGL00596:Dsg1c	APN	18	20281842	splice site	probably benign
IGL01412:Dsg1c	APN	18	20247461	missense	probably benign
IGL02037:Dsg1c	APN	18	20276950	missense	probably benign	0.02
IGL02247:Dsg1c	APN	18	20264316	missense	probably damaging	1.00
IGL02386:Dsg1c	APN	18	20276999	missense	probably benign
IGL02408:Dsg1c	APN	18	20274719	missense	probably damaging	1.00
IGL02519:Dsg1c	APN	18	20283733	missense	probably damaging	1.00
IGL02591:Dsg1c	APN	18	20275192	missense	probably damaging	1.00
IGL02730:Dsg1c	APN	18	20274830	missense	probably damaging	1.00
IGL02836:Dsg1c	APN	18	20267929	missense	probably benign	0.07
IGL03335:Dsg1c	APN	18	20283697	missense	probably benign	0.01
R0385:Dsg1c	UTSW	18	20283654	missense	probably damaging	1.00
R0561:Dsg1c	UTSW	18	20274775	missense	probably benign	0.04
R0570:Dsg1c	UTSW	18	20270378	missense	probably damaging	1.00
R0573:Dsg1c	UTSW	18	20279241	missense	probably benign	0.02
R0621:Dsg1c	UTSW	18	20279695	missense	possibly damaging	0.62
R0632:Dsg1c	UTSW	18	20272346	splice site	probably benign
R1183:Dsg1c	UTSW	18	20283198	missense	probably damaging	1.00
R1529:Dsg1c	UTSW	18	20282023	missense	probably damaging	1.00
R1596:Dsg1c	UTSW	18	20282047	missense	probably damaging	1.00
R1619:Dsg1c	UTSW	18	20264842	missense	probably benign	0.36
R1623:Dsg1c	UTSW	18	20275177	missense	probably damaging	1.00
R1844:Dsg1c	UTSW	18	20283039	splice site	probably null
R1881:Dsg1c	UTSW	18	20272540	splice site	probably benign
R2017:Dsg1c	UTSW	18	20266196	missense	possibly damaging	0.67
R2072:Dsg1c	UTSW	18	20275252	missense	probably benign	0.09
R2319:Dsg1c	UTSW	18	20275178	missense	probably damaging	1.00
R2340:Dsg1c	UTSW	18	20267888	missense	probably damaging	1.00
R3403:Dsg1c	UTSW	18	20270350	missense	probably damaging	1.00
R3407:Dsg1c	UTSW	18	20282058	critical splice donor site	probably null
R3874:Dsg1c	UTSW	18	20277052	missense	probably benign	0.02
R3910:Dsg1c	UTSW	18	20266196	missense	possibly damaging	0.67
R4535:Dsg1c	UTSW	18	20275265	missense	probably benign	0.01
R4739:Dsg1c	UTSW	18	20275189	missense	possibly damaging	0.95
R5165:Dsg1c	UTSW	18	20277023	missense	probably damaging	1.00
R5210:Dsg1c	UTSW	18	20274701	missense	probably damaging	0.97
R5253:Dsg1c	UTSW	18	20272379	missense	probably damaging	1.00
R5327:Dsg1c	UTSW	18	20267937	missense	possibly damaging	0.75
R5361:Dsg1c	UTSW	18	20283646	missense	possibly damaging	0.94
R5475:Dsg1c	UTSW	18	20282031	missense	probably damaging	0.99
R5512:Dsg1c	UTSW	18	20272511	missense	probably damaging	1.00
R5681:Dsg1c	UTSW	18	20283213	missense	probably damaging	1.00
R5710:Dsg1c	UTSW	18	20272351	missense	probably benign	0.06
R5889:Dsg1c	UTSW	18	20283601	missense	possibly damaging	0.87
R6513:Dsg1c	UTSW	18	20274630	missense	probably benign	0.01
R6596:Dsg1c	UTSW	18	20270524	intron	probably null
R6941:Dsg1c	UTSW	18	20267923	missense	probably damaging	0.96
R7041:Dsg1c	UTSW	18	20266144	missense	probably damaging	1.00
R7061:Dsg1c	UTSW	18	20277009	missense	probably benign
R7240:Dsg1c	UTSW	18	20283109	missense	probably damaging	1.00
X0026:Dsg1c	UTSW	18	20283258	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATGAGAGCAGGTCCTCAAG -3'
(R):5'- GGACTCTTCCAGAACTGTGTTC -3'

Sequencing Primer
(F):5'- TGAGAGCAGGTCCTCAAGAAAACC -3'
(R):5'- GAACTGTGTTCTCTCCATTGTG -3'

Posted On

2016-06-15