Incidental Mutation 'R5038:Olfr1461'
ID393138
Institutional Source Beutler Lab
Gene Symbol Olfr1461
Ensembl Gene ENSMUSG00000045883
Gene Nameolfactory receptor 1461
SynonymsGA_x6K02T2RE5P-3491834-3492772, MOR202-35
MMRRC Submission 042628-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R5038 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13163000-13168130 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13165591 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 192 (D192E)
Ref Sequence ENSEMBL: ENSMUSP00000146358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053772] [ENSMUST00000207113] [ENSMUST00000208489]
Predicted Effect probably benign
Transcript: ENSMUST00000053772
AA Change: D192E

PolyPhen 2 Score 0.391 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000053269
Gene: ENSMUSG00000045883
AA Change: D192E

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 6e-55 PFAM
Pfam:7TM_GPCR_Srsx 36 306 8e-6 PFAM
Pfam:7tm_1 42 291 2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207113
AA Change: D192E

PolyPhen 2 Score 0.391 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000208489
Meta Mutation Damage Score 0.1156 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 94% (64/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930512M02Rik A T 11: 11,589,375 probably null Het
Abtb2 G T 2: 103,567,063 G113C probably damaging Het
Acsm5 A G 7: 119,534,811 T272A probably damaging Het
Adprhl2 C T 4: 126,317,309 E272K possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Atp7b A C 8: 22,028,456 I122S possibly damaging Het
B230219D22Rik T C 13: 55,699,475 Y134H probably damaging Het
Bnc1 A G 7: 81,968,714 S868P probably damaging Het
Camta1 T C 4: 151,145,469 E302G probably damaging Het
Car1 A G 3: 14,770,873 Y129H probably damaging Het
Cdh22 T C 2: 165,142,277 T352A probably benign Het
Ckmt2 T C 13: 91,861,163 E215G probably benign Het
Cyb5r4 T G 9: 87,059,077 probably null Het
Dhrs13 A G 11: 78,032,430 probably benign Het
Dsg1c G A 18: 20,264,844 A34T probably benign Het
Epb41l1 T C 2: 156,521,410 V613A probably benign Het
Fam114a1 A G 5: 65,009,045 M240V probably damaging Het
Gm15455 T C 1: 33,838,176 noncoding transcript Het
Herc1 T G 9: 66,476,460 probably benign Het
Ifna11 T C 4: 88,820,077 V40A probably benign Het
Ifna15 T C 4: 88,558,029 N73D probably benign Het
Imp4 A T 1: 34,442,935 L45F probably damaging Het
Jak3 G A 8: 71,686,058 A967T probably damaging Het
Krtap19-2 A T 16: 88,874,028 Y76* probably null Het
Map4k5 A T 12: 69,824,614 N492K probably damaging Het
Mycbp2 C T 14: 103,296,939 R372H probably damaging Het
Nos2 G A 11: 78,922,314 S16N probably benign Het
Nr2c2 A G 6: 92,139,822 T2A probably damaging Het
Nup188 T C 2: 30,309,220 Y267H probably damaging Het
Nxph2 G A 2: 23,321,544 probably null Het
Olfr1446 T A 19: 12,890,406 H57L probably damaging Het
Olfr1505 T A 19: 13,919,458 V146E possibly damaging Het
Otof C T 5: 30,384,439 E761K possibly damaging Het
Pik3r1 C T 13: 101,689,444 R37Q probably damaging Het
Pkn3 T C 2: 30,085,281 probably null Het
Pold3 A G 7: 100,121,383 V14A probably damaging Het
Ptpn14 T C 1: 189,786,886 S38P probably damaging Het
Raf1 G A 6: 115,620,235 Q35* probably null Het
Rps3a1 C A 3: 86,138,031 E251D probably benign Het
Scd1 C T 19: 44,401,709 V207M probably damaging Het
Shq1 A G 6: 100,630,993 V319A probably benign Het
Slc4a8 T C 15: 100,795,821 Y416H probably damaging Het
Slco1a5 T C 6: 142,262,637 T143A probably benign Het
Slco1a5 C T 6: 142,266,364 G90D probably damaging Het
Snx9 T C 17: 5,887,073 V30A probably benign Het
Spdya T C 17: 71,588,566 probably benign Het
Stat1 A T 1: 52,123,209 N75I probably damaging Het
Sv2b A T 7: 75,157,425 M159K probably damaging Het
Tdh A T 14: 63,496,126 Y89* probably null Het
Tmc7 A G 7: 118,543,365 F600S probably damaging Het
Trpa1 T A 1: 14,910,866 H104L probably damaging Het
Ttn G A 2: 76,848,640 probably benign Het
Vmn1r113 A G 7: 20,787,494 I70M possibly damaging Het
Vmn1r171 A G 7: 23,632,763 M138V probably benign Het
Zfc3h1 G A 10: 115,404,211 V550I probably benign Het
Zfp335 G T 2: 164,910,644 S60* probably null Het
Zfp7 T C 15: 76,891,810 M684T probably benign Het
Zfp984 T A 4: 147,755,446 H316L probably damaging Het
Zmym2 T A 14: 56,956,180 Y1151N possibly damaging Het
Other mutations in Olfr1461
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Olfr1461 APN 19 13165371 missense probably damaging 1.00
IGL01370:Olfr1461 APN 19 13165299 missense possibly damaging 0.95
IGL01936:Olfr1461 APN 19 13165403 missense probably damaging 1.00
R0098:Olfr1461 UTSW 19 13165662 missense probably benign 0.12
R0270:Olfr1461 UTSW 19 13165887 missense probably damaging 1.00
R0575:Olfr1461 UTSW 19 13165387 nonsense probably null
R0627:Olfr1461 UTSW 19 13165250 missense probably benign 0.43
R1779:Olfr1461 UTSW 19 13165040 missense probably benign 0.00
R1956:Olfr1461 UTSW 19 13165196 missense probably damaging 1.00
R2446:Olfr1461 UTSW 19 13165447 missense probably benign 0.00
R3622:Olfr1461 UTSW 19 13165656 missense probably benign 0.06
R4485:Olfr1461 UTSW 19 13165491 missense possibly damaging 0.54
R4605:Olfr1461 UTSW 19 13165248 missense probably damaging 1.00
R4757:Olfr1461 UTSW 19 13165913 missense probably benign 0.01
R4816:Olfr1461 UTSW 19 13165124 missense probably benign 0.10
R7026:Olfr1461 UTSW 19 13165415 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TAGCAGTGTGTAAACCCCTAC -3'
(R):5'- GCTTGGCTGCAAATACATGAAG -3'

Sequencing Primer
(F):5'- GCAGTGTGTAAACCCCTACATTATAC -3'
(R):5'- TGGCTGCAAATACATGAAGATTATAG -3'
Posted On2016-06-15