Incidental Mutation 'R5038:Scd1'
ID393140
Institutional Source Beutler Lab
Gene Symbol Scd1
Ensembl Gene ENSMUSG00000037071
Gene Namestearoyl-Coenzyme A desaturase 1
SynonymsScd-1, stearoyl-CoA desaturase, SCD
MMRRC Submission 042628-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R5038 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location44394451-44407709 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44401709 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 207 (V207M)
Ref Sequence ENSEMBL: ENSMUSP00000036936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041331]
Predicted Effect probably damaging
Transcript: ENSMUST00000041331
AA Change: V207M

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036936
Gene: ENSMUSG00000037071
AA Change: V207M

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
transmembrane domain 67 89 N/A INTRINSIC
Pfam:FA_desaturase 93 313 2.4e-17 PFAM
Meta Mutation Damage Score 0.5282 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 94% (64/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in fatty acid biosynthesis, primarily the synthesis of oleic acid. The protein belongs to the fatty acid desaturase family and is an integral membrane protein located in the endoplasmic reticulum. Transcripts of approximately 3.9 and 5.2 kb, differing only by alternative polyadenlyation signals, have been detected. A gene encoding a similar enzyme is located on chromosome 4 and a pseudogene of this gene is located on chromosome 17. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit alopecia, scaly skin, sebaceous gland hypoplasia, impaired ocular lubrication and synthesis and storage of triglycerides, higher lipid oxidation, reduced growth, and lower fertility in females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930512M02Rik A T 11: 11,589,375 probably null Het
Abtb2 G T 2: 103,567,063 G113C probably damaging Het
Acsm5 A G 7: 119,534,811 T272A probably damaging Het
Adprhl2 C T 4: 126,317,309 E272K possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Atp7b A C 8: 22,028,456 I122S possibly damaging Het
B230219D22Rik T C 13: 55,699,475 Y134H probably damaging Het
Bnc1 A G 7: 81,968,714 S868P probably damaging Het
Camta1 T C 4: 151,145,469 E302G probably damaging Het
Car1 A G 3: 14,770,873 Y129H probably damaging Het
Cdh22 T C 2: 165,142,277 T352A probably benign Het
Ckmt2 T C 13: 91,861,163 E215G probably benign Het
Cyb5r4 T G 9: 87,059,077 probably null Het
Dhrs13 A G 11: 78,032,430 probably benign Het
Dsg1c G A 18: 20,264,844 A34T probably benign Het
Epb41l1 T C 2: 156,521,410 V613A probably benign Het
Fam114a1 A G 5: 65,009,045 M240V probably damaging Het
Gm15455 T C 1: 33,838,176 noncoding transcript Het
Herc1 T G 9: 66,476,460 probably benign Het
Ifna11 T C 4: 88,820,077 V40A probably benign Het
Ifna15 T C 4: 88,558,029 N73D probably benign Het
Imp4 A T 1: 34,442,935 L45F probably damaging Het
Jak3 G A 8: 71,686,058 A967T probably damaging Het
Krtap19-2 A T 16: 88,874,028 Y76* probably null Het
Map4k5 A T 12: 69,824,614 N492K probably damaging Het
Mycbp2 C T 14: 103,296,939 R372H probably damaging Het
Nos2 G A 11: 78,922,314 S16N probably benign Het
Nr2c2 A G 6: 92,139,822 T2A probably damaging Het
Nup188 T C 2: 30,309,220 Y267H probably damaging Het
Nxph2 G A 2: 23,321,544 probably null Het
Olfr1446 T A 19: 12,890,406 H57L probably damaging Het
Olfr1461 T A 19: 13,165,591 D192E probably benign Het
Olfr1505 T A 19: 13,919,458 V146E possibly damaging Het
Otof C T 5: 30,384,439 E761K possibly damaging Het
Pik3r1 C T 13: 101,689,444 R37Q probably damaging Het
Pkn3 T C 2: 30,085,281 probably null Het
Pold3 A G 7: 100,121,383 V14A probably damaging Het
Ptpn14 T C 1: 189,786,886 S38P probably damaging Het
Raf1 G A 6: 115,620,235 Q35* probably null Het
Rps3a1 C A 3: 86,138,031 E251D probably benign Het
Shq1 A G 6: 100,630,993 V319A probably benign Het
Slc4a8 T C 15: 100,795,821 Y416H probably damaging Het
Slco1a5 T C 6: 142,262,637 T143A probably benign Het
Slco1a5 C T 6: 142,266,364 G90D probably damaging Het
Snx9 T C 17: 5,887,073 V30A probably benign Het
Spdya T C 17: 71,588,566 probably benign Het
Stat1 A T 1: 52,123,209 N75I probably damaging Het
Sv2b A T 7: 75,157,425 M159K probably damaging Het
Tdh A T 14: 63,496,126 Y89* probably null Het
Tmc7 A G 7: 118,543,365 F600S probably damaging Het
Trpa1 T A 1: 14,910,866 H104L probably damaging Het
Ttn G A 2: 76,848,640 probably benign Het
Vmn1r113 A G 7: 20,787,494 I70M possibly damaging Het
Vmn1r171 A G 7: 23,632,763 M138V probably benign Het
Zfc3h1 G A 10: 115,404,211 V550I probably benign Het
Zfp335 G T 2: 164,910,644 S60* probably null Het
Zfp7 T C 15: 76,891,810 M684T probably benign Het
Zfp984 T A 4: 147,755,446 H316L probably damaging Het
Zmym2 T A 14: 56,956,180 Y1151N possibly damaging Het
Other mutations in Scd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Scd1 APN 19 44400357 missense possibly damaging 0.47
IGL01781:Scd1 APN 19 44400348 missense possibly damaging 0.53
IGL02016:Scd1 APN 19 44400307 missense probably benign 0.02
IGL02251:Scd1 APN 19 44398094 missense probably damaging 1.00
copycat UTSW 19 44406488 missense probably benign
flake UTSW 19 44400330 missense probably damaging 1.00
R2182:Scd1 UTSW 19 44403293 missense probably benign
R4635:Scd1 UTSW 19 44406585 missense probably damaging 1.00
R5511:Scd1 UTSW 19 44406759 missense probably benign 0.31
R5965:Scd1 UTSW 19 44400140 critical splice donor site probably null
R6746:Scd1 UTSW 19 44406488 missense probably benign
R7133:Scd1 UTSW 19 44406595 missense probably damaging 1.00
R7593:Scd1 UTSW 19 44400300 missense probably benign 0.00
Z1088:Scd1 UTSW 19 44397923 missense probably benign 0.28
Z1176:Scd1 UTSW 19 44403218 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAGCAGGATGGCTCAGGC -3'
(R):5'- TGCTTCCAGAATGACGTGTACG -3'

Sequencing Primer
(F):5'- CTCAGGCAGAAACATTATGCCTTGG -3'
(R):5'- CTTCCAGAATGACGTGTACGAATGG -3'
Posted On2016-06-15