Mutagenetix > Incidental Mutation

Incidental Mutation 'R5040:Sh3bp4'

393144

Institutional Source

Beutler Lab

Gene Symbol

Sh3bp4

Ensembl Gene

ENSMUSG00000036206

Gene Name

SH3-domain binding protein 4

Synonyms

BOG25

MMRRC Submission

042630-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5040 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

89070415-89155068 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 89144240 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 270 (S270L)

Ref Sequence

ENSEMBL: ENSMUSP00000067581 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066279]

AlphaFold

Q921I6

Predicted Effect

probably damaging
Transcript: ENSMUST00000066279
AA Change: S270L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000067581
Gene: ENSMUSG00000036206
AA Change: S270L

Domain	Start	End	E-Value	Type
SH3	58	113	5.04e-13	SMART
low complexity region	196	212	N/A	INTRINSIC
Pfam:ZU5	318	411	1.8e-12	PFAM
Pfam:SH3_2	657	721	3.5e-13	PFAM

Meta Mutation Damage Score

0.1090

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.2%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 3 Asn-Pro-Phe (NPF) motifs, an SH3 domain, a PXXP motif, a bipartite nuclear targeting signal, and a tyrosine phosphorylation site. This protein is involved in cargo-specific control of clathrin-mediated endocytosis, specifically controlling the internalization of a specific protein receptor. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	T	A	3: 108,475,001	D284V	probably damaging	Het
Abcc6	T	C	7: 46,020,154	Q159R	probably benign	Het
AF067063	C	T	13: 119,828,489	W57*	probably null	Het
Ap2a1	T	C	7: 44,905,804	I446V	possibly damaging	Het
Areg	A	T	5: 91,144,339	H166L	possibly damaging	Het
Arhgap15	T	C	2: 43,844,813		probably null	Het
Arhgef17	T	C	7: 100,876,825	D874G	probably benign	Het
Cast	T	C	13: 74,724,813	T452A	probably damaging	Het
Ccdc154	A	T	17: 25,164,592	T208S	probably benign	Het
Chst11	T	A	10: 83,190,946	L69Q	probably benign	Het
Clec2d	G	A	6: 129,184,830	R142K	probably damaging	Het
Dis3l2	A	T	1: 86,857,337	I303F	probably damaging	Het
Dusp27	G	A	1: 166,100,345	T566I	probably benign	Het
Dync2h1	A	G	9: 6,992,625	Y3979H	probably benign	Het
Ehmt1	A	T	2: 24,884,304	C162S	probably benign	Het
Eif4g3	G	T	4: 138,096,889	M239I	probably damaging	Het
Eif5	A	G	12: 111,539,850	D41G	probably damaging	Het
Fat1	C	T	8: 45,023,380	A1821V	probably damaging	Het
Fry	G	A	5: 150,388,854	A745T	probably damaging	Het
Galnt9	T	C	5: 110,617,905	L491P	probably damaging	Het
Gata3	A	G	2: 9,858,515	L396P	probably damaging	Het
Grasp	G	A	15: 101,229,042	V134I	probably damaging	Het
Gyg	A	G	3: 20,122,659		probably benign	Het
Hhip	C	A	8: 79,997,606	V336L	probably benign	Het
Hipk2	G	A	6: 38,730,881	P660S	possibly damaging	Het
Hnrnpul1	G	A	7: 25,742,989	T276I	possibly damaging	Het
Ifnl2	G	T	7: 28,509,086	R147S	possibly damaging	Het
Ilvbl	A	G	10: 78,583,318	D467G	probably damaging	Het
Kcnh1	A	T	1: 192,505,475	H748L	probably benign	Het
Lyg1	A	C	1: 37,950,811		probably benign	Het
Mak	A	G	13: 41,030,098	Y544H	possibly damaging	Het
Med1	A	G	11: 98,155,404		probably benign	Het
Mogat2	T	C	7: 99,238,517	T17A	possibly damaging	Het
Myom3	T	C	4: 135,789,659	S847P	probably damaging	Het
Nprl2	T	G	9: 107,542,400	C9G	probably null	Het
Olfr1456-ps1	T	A	19: 13,078,943		noncoding transcript	Het
Pcmtd1	T	C	1: 7,120,375	Y23H	probably damaging	Het
Pkd1	C	A	17: 24,571,260	H972Q	probably benign	Het
Rbm26	A	G	14: 105,121,016	I929T	probably benign	Het
Scrn2	A	G	11: 97,030,883	T60A	probably damaging	Het
Setdb2	A	T	14: 59,415,707	I398N	probably damaging	Het
Setx	A	G	2: 29,139,338	E206G	probably damaging	Het
Sez6	T	C	11: 77,969,089		probably null	Het
Stac3	T	C	10: 127,508,124	I297T	probably damaging	Het
Supv3l1	A	T	10: 62,447,065	V139E	possibly damaging	Het
Syce1	A	T	7: 140,779,065	H178Q	probably damaging	Het
Tcp10c	T	A	17: 13,368,191	M344K	possibly damaging	Het
Tmc1	A	G	19: 20,824,030	V502A	possibly damaging	Het
Tmco4	G	T	4: 139,020,166	G242V	probably damaging	Het
Trp53bp2	G	A	1: 182,444,706	R460H	probably damaging	Het
Virma	T	A	4: 11,528,746	C1328S	probably benign	Het
Zfp366	A	G	13: 99,228,367	D12G	probably damaging	Het
Zfp457	C	T	13: 67,292,835	A463T	probably benign	Het

Other mutations in Sh3bp4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01062:Sh3bp4	APN	1	89143960	missense	probably benign
IGL01344:Sh3bp4	APN	1	89153236	missense	probably benign
IGL02025:Sh3bp4	APN	1	89145286	missense	probably benign	0.40
IGL02035:Sh3bp4	APN	1	89143690	missense	probably benign	0.00
IGL02389:Sh3bp4	APN	1	89145148	missense	probably damaging	0.99
IGL02430:Sh3bp4	APN	1	89153163	missense	probably null	0.00
IGL02546:Sh3bp4	APN	1	89143544	splice site	probably benign
IGL03327:Sh3bp4	APN	1	89144163	nonsense	probably null
I0000:Sh3bp4	UTSW	1	89137796	missense	probably benign	0.01
PIT4366001:Sh3bp4	UTSW	1	89145434	missense	probably benign
R0128:Sh3bp4	UTSW	1	89145314	missense	possibly damaging	0.54
R0130:Sh3bp4	UTSW	1	89145314	missense	possibly damaging	0.54
R1370:Sh3bp4	UTSW	1	89143772	missense	probably benign	0.43
R1500:Sh3bp4	UTSW	1	89145488	missense	probably damaging	1.00
R2269:Sh3bp4	UTSW	1	89145592	missense	possibly damaging	0.62
R3407:Sh3bp4	UTSW	1	89145047	missense	possibly damaging	0.86
R3408:Sh3bp4	UTSW	1	89145047	missense	possibly damaging	0.86
R3615:Sh3bp4	UTSW	1	89137705	missense	probably damaging	0.99
R3616:Sh3bp4	UTSW	1	89137705	missense	probably damaging	0.99
R3721:Sh3bp4	UTSW	1	89145328	missense	possibly damaging	0.93
R3983:Sh3bp4	UTSW	1	89145869	missense	probably benign	0.00
R4631:Sh3bp4	UTSW	1	89144273	missense	probably damaging	1.00
R5024:Sh3bp4	UTSW	1	89145595	missense	probably damaging	1.00
R5249:Sh3bp4	UTSW	1	89137734	missense	probably damaging	1.00
R5306:Sh3bp4	UTSW	1	89144275	missense	probably damaging	0.99
R5319:Sh3bp4	UTSW	1	89145350	missense	probably benign
R5908:Sh3bp4	UTSW	1	89145883	missense	probably damaging	0.99
R6296:Sh3bp4	UTSW	1	89145489	missense	probably damaging	1.00
R6572:Sh3bp4	UTSW	1	89144921	missense	possibly damaging	0.78
R6660:Sh3bp4	UTSW	1	89153166	missense	possibly damaging	0.62
R6900:Sh3bp4	UTSW	1	89145767	missense	probably benign	0.00
R7319:Sh3bp4	UTSW	1	89153102	splice site	probably null
R7320:Sh3bp4	UTSW	1	89145494	missense	probably damaging	1.00
R7393:Sh3bp4	UTSW	1	89144448	missense	possibly damaging	0.79
R7516:Sh3bp4	UTSW	1	89145646	missense	probably damaging	1.00
R8402:Sh3bp4	UTSW	1	89145315	missense	probably benign	0.00
R8899:Sh3bp4	UTSW	1	89145575	missense	probably benign	0.45
R8915:Sh3bp4	UTSW	1	89152342	missense	probably damaging	0.99
R8953:Sh3bp4	UTSW	1	89144437	missense	probably damaging	0.97
R9137:Sh3bp4	UTSW	1	89144925	nonsense	probably null
R9718:Sh3bp4	UTSW	1	89145750	missense	probably damaging	0.99
RF016:Sh3bp4	UTSW	1	89145022	missense	probably benign
Z1176:Sh3bp4	UTSW	1	89145728	missense	probably benign	0.43

Predicted Primers

PCR Primer
(F):5'- ACATCTTTGATGAGCTCCCAGC -3'
(R):5'- AATCTGCTGTGTCTCCCCAG -3'

Sequencing Primer
(F):5'- TGAGCTCCCAGCCACCAATG -3'
(R):5'- CCTCTGGCACATGGATACTGATG -3'

Posted On

2016-06-15