Mutagenetix > Incidental Mutations

Incidental Mutation 'R5040:Hnrnpul1'

393167

Institutional Source

Beutler Lab

Gene Symbol

Hnrnpul1

Ensembl Gene

ENSMUSG00000040725

Gene Name

heterogeneous nuclear ribonucleoprotein U-like 1

Synonyms

E1B-AP5, E130317O14Rik, E1BAP5, Hnrpul1, Hnrnpul

MMRRC Submission

042630-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.592) question?

Stock #

R5040 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25721165-25754757 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 25742989 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 276 (T276I)

Ref Sequence

ENSEMBL: ENSMUSP00000146263 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043765] [ENSMUST00000108401] [ENSMUST00000206832]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043765
AA Change: T176I

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000037268
Gene: ENSMUSG00000040725
AA Change: T176I

Domain	Start	End	E-Value	Type
SAP	3	37	2.86e-10	SMART
low complexity region	62	74	N/A	INTRINSIC
low complexity region	78	91	N/A	INTRINSIC
low complexity region	201	209	N/A	INTRINSIC
SPRY	255	388	8.49e-41	SMART
Pfam:AAA_33	424	569	1.4e-29	PFAM
low complexity region	613	626	N/A	INTRINSIC
low complexity region	631	693	N/A	INTRINSIC
low complexity region	695	718	N/A	INTRINSIC
low complexity region	745	765	N/A	INTRINSIC
low complexity region	768	859	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108401
AA Change: T276I

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000104038
Gene: ENSMUSG00000040725
AA Change: T276I

Domain	Start	End	E-Value	Type
SAP	3	37	2.86e-10	SMART
low complexity region	62	74	N/A	INTRINSIC
low complexity region	78	91	N/A	INTRINSIC
low complexity region	201	209	N/A	INTRINSIC
Pfam:SPRY	255	338	2e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206041

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206260

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206832
AA Change: T276I

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)

Meta Mutation Damage Score

0.1174

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.2%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear RNA-binding protein of the heterogeneous nuclear ribonucleoprotein (hnRNP) family. This protein binds specifically to adenovirus early-1B-55kDa oncoprotein. It may play an important role in nucleocytoplasmic RNA transport, and its function is modulated by early-1B-55kDa in adenovirus-infected cells. [provided by RefSeq, Mar 2016]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	T	A	3: 108,475,001	D284V	probably damaging	Het
Abcc6	T	C	7: 46,020,154	Q159R	probably benign	Het
AF067063	C	T	13: 119,828,489	W57*	probably null	Het
Ap2a1	T	C	7: 44,905,804	I446V	possibly damaging	Het
Areg	A	T	5: 91,144,339	H166L	possibly damaging	Het
Arhgap15	T	C	2: 43,844,813		probably null	Het
Arhgef17	T	C	7: 100,876,825	D874G	probably benign	Het
Cast	T	C	13: 74,724,813	T452A	probably damaging	Het
Ccdc154	A	T	17: 25,164,592	T208S	probably benign	Het
Chst11	T	A	10: 83,190,946	L69Q	probably benign	Het
Clec2d	G	A	6: 129,184,830	R142K	probably damaging	Het
Dis3l2	A	T	1: 86,857,337	I303F	probably damaging	Het
Dusp27	G	A	1: 166,100,345	T566I	probably benign	Het
Dync2h1	A	G	9: 6,992,625	Y3979H	probably benign	Het
Ehmt1	A	T	2: 24,884,304	C162S	probably benign	Het
Eif4g3	G	T	4: 138,096,889	M239I	probably damaging	Het
Eif5	A	G	12: 111,539,850	D41G	probably damaging	Het
Fat1	C	T	8: 45,023,380	A1821V	probably damaging	Het
Fry	G	A	5: 150,388,854	A745T	probably damaging	Het
Galnt9	T	C	5: 110,617,905	L491P	probably damaging	Het
Gata3	A	G	2: 9,858,515	L396P	probably damaging	Het
Grasp	G	A	15: 101,229,042	V134I	probably damaging	Het
Gyg	A	G	3: 20,122,659		probably benign	Het
Hhip	C	A	8: 79,997,606	V336L	probably benign	Het
Hipk2	G	A	6: 38,730,881	P660S	possibly damaging	Het
Ifnl2	G	T	7: 28,509,086	R147S	possibly damaging	Het
Ilvbl	A	G	10: 78,583,318	D467G	probably damaging	Het
Kcnh1	A	T	1: 192,505,475	H748L	probably benign	Het
Lyg1	A	C	1: 37,950,811		probably benign	Het
Mak	A	G	13: 41,030,098	Y544H	possibly damaging	Het
Med1	A	G	11: 98,155,404		probably benign	Het
Mogat2	T	C	7: 99,238,517	T17A	possibly damaging	Het
Myom3	T	C	4: 135,789,659	S847P	probably damaging	Het
Nprl2	T	G	9: 107,542,400	C9G	probably null	Het
Olfr1456-ps1	T	A	19: 13,078,943		noncoding transcript	Het
Pcmtd1	T	C	1: 7,120,375	Y23H	probably damaging	Het
Pkd1	C	A	17: 24,571,260	H972Q	probably benign	Het
Rbm26	A	G	14: 105,121,016	I929T	probably benign	Het
Scrn2	A	G	11: 97,030,883	T60A	probably damaging	Het
Setdb2	A	T	14: 59,415,707	I398N	probably damaging	Het
Setx	A	G	2: 29,139,338	E206G	probably damaging	Het
Sez6	T	C	11: 77,969,089		probably null	Het
Sh3bp4	C	T	1: 89,144,240	S270L	probably damaging	Het
Stac3	T	C	10: 127,508,124	I297T	probably damaging	Het
Supv3l1	A	T	10: 62,447,065	V139E	possibly damaging	Het
Syce1	A	T	7: 140,779,065	H178Q	probably damaging	Het
Tcp10c	T	A	17: 13,368,191	M344K	possibly damaging	Het
Tmc1	A	G	19: 20,824,030	V502A	possibly damaging	Het
Tmco4	G	T	4: 139,020,166	G242V	probably damaging	Het
Trp53bp2	G	A	1: 182,444,706	R460H	probably damaging	Het
Virma	T	A	4: 11,528,746	C1328S	probably benign	Het
Zfp366	A	G	13: 99,228,367	D12G	probably damaging	Het
Zfp457	C	T	13: 67,292,835	A463T	probably benign	Het

Other mutations in Hnrnpul1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Hnrnpul1	APN	7	25726154	missense	possibly damaging	0.74
IGL01287:Hnrnpul1	APN	7	25726898	missense	probably damaging	1.00
IGL01409:Hnrnpul1	APN	7	25724652	missense	unknown
IGL02026:Hnrnpul1	APN	7	25745162	missense	probably damaging	0.99
IGL02073:Hnrnpul1	APN	7	25722341	unclassified	probably benign
IGL02474:Hnrnpul1	APN	7	25726757	missense	probably benign	0.02
IGL02839:Hnrnpul1	APN	7	25733242	critical splice donor site	probably null
IGL02894:Hnrnpul1	APN	7	25750904	missense	possibly damaging	0.70
IGL03382:Hnrnpul1	APN	7	25750984	start codon destroyed	probably null	0.53
R0011:Hnrnpul1	UTSW	7	25742915	splice site	probably benign
R0525:Hnrnpul1	UTSW	7	25740883	missense	possibly damaging	0.72
R0587:Hnrnpul1	UTSW	7	25745232	missense	possibly damaging	0.70
R1121:Hnrnpul1	UTSW	7	25740907	missense	possibly damaging	0.68
R1313:Hnrnpul1	UTSW	7	25722916	unclassified	probably benign
R1313:Hnrnpul1	UTSW	7	25722916	unclassified	probably benign
R1880:Hnrnpul1	UTSW	7	25733098	missense	possibly damaging	0.95
R1892:Hnrnpul1	UTSW	7	25726766	missense	probably benign	0.11
R2113:Hnrnpul1	UTSW	7	25733269	missense	possibly damaging	0.47
R2194:Hnrnpul1	UTSW	7	25725922	critical splice donor site	probably null
R2269:Hnrnpul1	UTSW	7	25750874	missense	probably damaging	0.98
R2679:Hnrnpul1	UTSW	7	25726875	missense	probably damaging	1.00
R3079:Hnrnpul1	UTSW	7	25733115	nonsense	probably null
R3917:Hnrnpul1	UTSW	7	25726875	missense	probably damaging	1.00
R4077:Hnrnpul1	UTSW	7	25726875	missense	probably damaging	1.00
R4079:Hnrnpul1	UTSW	7	25726875	missense	probably damaging	1.00
R4181:Hnrnpul1	UTSW	7	25726812	missense	probably damaging	0.98
R4449:Hnrnpul1	UTSW	7	25722284	unclassified	probably benign
R4707:Hnrnpul1	UTSW	7	25726833	missense	probably damaging	1.00
R4764:Hnrnpul1	UTSW	7	25743011	missense	probably benign	0.00
R5131:Hnrnpul1	UTSW	7	25726794	missense	probably benign	0.08
R5224:Hnrnpul1	UTSW	7	25745175	missense	probably damaging	0.98
R5599:Hnrnpul1	UTSW	7	25754672	start gained	probably benign
R5975:Hnrnpul1	UTSW	7	25754359	missense	possibly damaging	0.93
R7032:Hnrnpul1	UTSW	7	25750894	missense	probably benign	0.11
R7195:Hnrnpul1	UTSW	7	25724778	missense	unknown
R7231:Hnrnpul1	UTSW	7	25748417	nonsense	probably null
R7667:Hnrnpul1	UTSW	7	25754421	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCAGTAACACAAAATTAACAGGTGC -3'
(R):5'- CGACTTGAGCTCCTGTTCTAGC -3'

Sequencing Primer
(F):5'- CCCCCACCCCCAGTAGG -3'
(R):5'- AGCCTCACTGTGTAACTTAAGCTGG -3'

Posted On

2016-06-15