Incidental Mutation 'R5040:Hnrnpul1'
ID393167
Institutional Source Beutler Lab
Gene Symbol Hnrnpul1
Ensembl Gene ENSMUSG00000040725
Gene Nameheterogeneous nuclear ribonucleoprotein U-like 1
SynonymsE1B-AP5, E130317O14Rik, E1BAP5, Hnrpul1, Hnrnpul
MMRRC Submission 042630-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.592) question?
Stock #R5040 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location25721165-25754757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25742989 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 276 (T276I)
Ref Sequence ENSEMBL: ENSMUSP00000146263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043765] [ENSMUST00000108401] [ENSMUST00000206832]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043765
AA Change: T176I

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037268
Gene: ENSMUSG00000040725
AA Change: T176I

DomainStartEndE-ValueType
SAP 3 37 2.86e-10 SMART
low complexity region 62 74 N/A INTRINSIC
low complexity region 78 91 N/A INTRINSIC
low complexity region 201 209 N/A INTRINSIC
SPRY 255 388 8.49e-41 SMART
Pfam:AAA_33 424 569 1.4e-29 PFAM
low complexity region 613 626 N/A INTRINSIC
low complexity region 631 693 N/A INTRINSIC
low complexity region 695 718 N/A INTRINSIC
low complexity region 745 765 N/A INTRINSIC
low complexity region 768 859 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108401
AA Change: T276I

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104038
Gene: ENSMUSG00000040725
AA Change: T276I

DomainStartEndE-ValueType
SAP 3 37 2.86e-10 SMART
low complexity region 62 74 N/A INTRINSIC
low complexity region 78 91 N/A INTRINSIC
low complexity region 201 209 N/A INTRINSIC
Pfam:SPRY 255 338 2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206260
Predicted Effect possibly damaging
Transcript: ENSMUST00000206832
AA Change: T276I

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.1174 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear RNA-binding protein of the heterogeneous nuclear ribonucleoprotein (hnRNP) family. This protein binds specifically to adenovirus early-1B-55kDa oncoprotein. It may play an important role in nucleocytoplasmic RNA transport, and its function is modulated by early-1B-55kDa in adenovirus-infected cells. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,475,001 D284V probably damaging Het
Abcc6 T C 7: 46,020,154 Q159R probably benign Het
AF067063 C T 13: 119,828,489 W57* probably null Het
Ap2a1 T C 7: 44,905,804 I446V possibly damaging Het
Areg A T 5: 91,144,339 H166L possibly damaging Het
Arhgap15 T C 2: 43,844,813 probably null Het
Arhgef17 T C 7: 100,876,825 D874G probably benign Het
Cast T C 13: 74,724,813 T452A probably damaging Het
Ccdc154 A T 17: 25,164,592 T208S probably benign Het
Chst11 T A 10: 83,190,946 L69Q probably benign Het
Clec2d G A 6: 129,184,830 R142K probably damaging Het
Dis3l2 A T 1: 86,857,337 I303F probably damaging Het
Dusp27 G A 1: 166,100,345 T566I probably benign Het
Dync2h1 A G 9: 6,992,625 Y3979H probably benign Het
Ehmt1 A T 2: 24,884,304 C162S probably benign Het
Eif4g3 G T 4: 138,096,889 M239I probably damaging Het
Eif5 A G 12: 111,539,850 D41G probably damaging Het
Fat1 C T 8: 45,023,380 A1821V probably damaging Het
Fry G A 5: 150,388,854 A745T probably damaging Het
Galnt9 T C 5: 110,617,905 L491P probably damaging Het
Gata3 A G 2: 9,858,515 L396P probably damaging Het
Grasp G A 15: 101,229,042 V134I probably damaging Het
Gyg A G 3: 20,122,659 probably benign Het
Hhip C A 8: 79,997,606 V336L probably benign Het
Hipk2 G A 6: 38,730,881 P660S possibly damaging Het
Ifnl2 G T 7: 28,509,086 R147S possibly damaging Het
Ilvbl A G 10: 78,583,318 D467G probably damaging Het
Kcnh1 A T 1: 192,505,475 H748L probably benign Het
Lyg1 A C 1: 37,950,811 probably benign Het
Mak A G 13: 41,030,098 Y544H possibly damaging Het
Med1 A G 11: 98,155,404 probably benign Het
Mogat2 T C 7: 99,238,517 T17A possibly damaging Het
Myom3 T C 4: 135,789,659 S847P probably damaging Het
Nprl2 T G 9: 107,542,400 C9G probably null Het
Olfr1456-ps1 T A 19: 13,078,943 noncoding transcript Het
Pcmtd1 T C 1: 7,120,375 Y23H probably damaging Het
Pkd1 C A 17: 24,571,260 H972Q probably benign Het
Rbm26 A G 14: 105,121,016 I929T probably benign Het
Scrn2 A G 11: 97,030,883 T60A probably damaging Het
Setdb2 A T 14: 59,415,707 I398N probably damaging Het
Setx A G 2: 29,139,338 E206G probably damaging Het
Sez6 T C 11: 77,969,089 probably null Het
Sh3bp4 C T 1: 89,144,240 S270L probably damaging Het
Stac3 T C 10: 127,508,124 I297T probably damaging Het
Supv3l1 A T 10: 62,447,065 V139E possibly damaging Het
Syce1 A T 7: 140,779,065 H178Q probably damaging Het
Tcp10c T A 17: 13,368,191 M344K possibly damaging Het
Tmc1 A G 19: 20,824,030 V502A possibly damaging Het
Tmco4 G T 4: 139,020,166 G242V probably damaging Het
Trp53bp2 G A 1: 182,444,706 R460H probably damaging Het
Virma T A 4: 11,528,746 C1328S probably benign Het
Zfp366 A G 13: 99,228,367 D12G probably damaging Het
Zfp457 C T 13: 67,292,835 A463T probably benign Het
Other mutations in Hnrnpul1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Hnrnpul1 APN 7 25726154 missense possibly damaging 0.74
IGL01287:Hnrnpul1 APN 7 25726898 missense probably damaging 1.00
IGL01409:Hnrnpul1 APN 7 25724652 missense unknown
IGL02026:Hnrnpul1 APN 7 25745162 missense probably damaging 0.99
IGL02073:Hnrnpul1 APN 7 25722341 unclassified probably benign
IGL02474:Hnrnpul1 APN 7 25726757 missense probably benign 0.02
IGL02839:Hnrnpul1 APN 7 25733242 critical splice donor site probably null
IGL02894:Hnrnpul1 APN 7 25750904 missense possibly damaging 0.70
IGL03382:Hnrnpul1 APN 7 25750984 start codon destroyed probably null 0.53
R0011:Hnrnpul1 UTSW 7 25742915 splice site probably benign
R0525:Hnrnpul1 UTSW 7 25740883 missense possibly damaging 0.72
R0587:Hnrnpul1 UTSW 7 25745232 missense possibly damaging 0.70
R1121:Hnrnpul1 UTSW 7 25740907 missense possibly damaging 0.68
R1313:Hnrnpul1 UTSW 7 25722916 unclassified probably benign
R1313:Hnrnpul1 UTSW 7 25722916 unclassified probably benign
R1880:Hnrnpul1 UTSW 7 25733098 missense possibly damaging 0.95
R1892:Hnrnpul1 UTSW 7 25726766 missense probably benign 0.11
R2113:Hnrnpul1 UTSW 7 25733269 missense possibly damaging 0.47
R2194:Hnrnpul1 UTSW 7 25725922 critical splice donor site probably null
R2269:Hnrnpul1 UTSW 7 25750874 missense probably damaging 0.98
R2679:Hnrnpul1 UTSW 7 25726875 missense probably damaging 1.00
R3079:Hnrnpul1 UTSW 7 25733115 nonsense probably null
R3917:Hnrnpul1 UTSW 7 25726875 missense probably damaging 1.00
R4077:Hnrnpul1 UTSW 7 25726875 missense probably damaging 1.00
R4079:Hnrnpul1 UTSW 7 25726875 missense probably damaging 1.00
R4181:Hnrnpul1 UTSW 7 25726812 missense probably damaging 0.98
R4449:Hnrnpul1 UTSW 7 25722284 unclassified probably benign
R4707:Hnrnpul1 UTSW 7 25726833 missense probably damaging 1.00
R4764:Hnrnpul1 UTSW 7 25743011 missense probably benign 0.00
R5131:Hnrnpul1 UTSW 7 25726794 missense probably benign 0.08
R5224:Hnrnpul1 UTSW 7 25745175 missense probably damaging 0.98
R5599:Hnrnpul1 UTSW 7 25754672 start gained probably benign
R5975:Hnrnpul1 UTSW 7 25754359 missense possibly damaging 0.93
R7032:Hnrnpul1 UTSW 7 25750894 missense probably benign 0.11
R7195:Hnrnpul1 UTSW 7 25724778 missense unknown
R7231:Hnrnpul1 UTSW 7 25748417 nonsense probably null
R7667:Hnrnpul1 UTSW 7 25754421 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGTAACACAAAATTAACAGGTGC -3'
(R):5'- CGACTTGAGCTCCTGTTCTAGC -3'

Sequencing Primer
(F):5'- CCCCCACCCCCAGTAGG -3'
(R):5'- AGCCTCACTGTGTAACTTAAGCTGG -3'
Posted On2016-06-15