Mutagenetix > Incidental Mutation

Incidental Mutation 'R0445:Trpm1'

39317

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

038646-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0445 (G1)

Quality Score

126

Status

Validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 64244842 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000146073 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206848]

AlphaFold

Q2TV84

Predicted Effect

probably benign
Transcript: ENSMUST00000085222

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000107525

SMART Domains

Protein: ENSMUSP00000103149
Gene: ENSMUSG00000030523

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
Pfam:Ion_trans	876	1138	7.6e-22	PFAM
transmembrane domain	1156	1173	N/A	INTRINSIC
Pfam:TRPM_tetra	1230	1285	9.4e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205466

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206000

Predicted Effect

probably benign
Transcript: ENSMUST00000206263

Predicted Effect

probably benign
Transcript: ENSMUST00000206277

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Predicted Effect

probably benign
Transcript: ENSMUST00000206848

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.3%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700067P10Rik	A	C	17: 48,090,022		probably null	Het
4932438A13Rik	T	C	3: 37,000,065	V3111A	probably damaging	Het
A2m	C	T	6: 121,657,955	T687I	probably damaging	Het
Acsbg1	A	G	9: 54,615,895	S483P	probably damaging	Het
Adam22	T	A	5: 8,180,591		probably benign	Het
Aggf1	A	G	13: 95,354,001	V595A	possibly damaging	Het
Aplf	A	T	6: 87,663,752	L71I	probably damaging	Het
Arid3c	G	T	4: 41,725,172	P292T	probably benign	Het
Brms1l	T	A	12: 55,861,406	Y213*	probably null	Het
C87436	T	A	6: 86,449,850	S332T	possibly damaging	Het
Cad	G	A	5: 31,072,709	A1454T	probably benign	Het
Cdkn3	T	C	14: 46,767,400		probably null	Het
Cnot1	A	G	8: 95,760,208	C624R	probably damaging	Het
Cntnap5c	A	T	17: 58,104,743	I541F	probably benign	Het
Cyhr1	T	C	15: 76,648,257	H217R	probably damaging	Het
Dennd1b	A	G	1: 139,167,765		probably benign	Het
Dscam	A	T	16: 96,772,503	I753N	probably damaging	Het
Eef2	C	CN	10: 81,178,770		probably null	Het
Epg5	T	A	18: 78,014,184	V1826D	possibly damaging	Het
Epha8	T	C	4: 136,932,400	Y755C	probably damaging	Het
Esco1	A	T	18: 10,574,989	N694K	probably damaging	Het
Fermt3	T	C	19: 7,003,299	H300R	probably benign	Het
Galnt5	C	A	2: 57,998,950	F187L	probably benign	Het
Gm17067	A	G	7: 42,708,622	I152T	probably benign	Het
Gnb3	T	C	6: 124,837,255	D154G	possibly damaging	Het
Gpr155	G	A	2: 73,370,144		probably benign	Het
Hdac3	A	G	18: 37,943,724	I240T	probably damaging	Het
Ifitm1	A	T	7: 140,968,441		probably null	Het
Kif1b	A	T	4: 149,188,009	L1455Q	probably benign	Het
Krt1	A	C	15: 101,847,621	L388R	probably damaging	Het
Lrp1	T	A	10: 127,590,636	K635*	probably null	Het
Map3k2	A	G	18: 32,217,210	Y371C	probably damaging	Het
Mcu	T	C	10: 59,456,645		probably benign	Het
Mkrn1	C	T	6: 39,404,854	V167I	probably benign	Het
Mrpl9	T	A	3: 94,444,891		probably benign	Het
Naip2	T	C	13: 100,161,887	Y547C	possibly damaging	Het
Nup88	G	A	11: 70,947,729	T487I	probably benign	Het
Oas3	G	A	5: 120,756,145	R39C	probably damaging	Het
Obscn	C	T	11: 58,999,335	R7457H	unknown	Het
Olfr1383	T	A	11: 49,523,957	V78E	probably damaging	Het
Olfr272	G	A	4: 52,910,849	T315M	probably benign	Het
Paf1	T	C	7: 28,395,688	S118P	probably damaging	Het
Parp4	T	A	14: 56,602,748		probably null	Het
Pcdh15	A	T	10: 74,342,549	Y157F	probably damaging	Het
Pex10	G	A	4: 155,069,074		probably null	Het
Phrf1	C	T	7: 141,247,331		probably benign	Het
Polr3a	G	T	14: 24,454,921	D1090E	probably benign	Het
Ppfia4	A	C	1: 134,327,289	L276R	probably benign	Het
Rdh16f1	T	C	10: 127,790,867	L263S	probably benign	Het
Ryr3	T	C	2: 112,866,054	D967G	probably benign	Het
Shc1	G	T	3: 89,426,537	A226S	probably damaging	Het
Slc4a1	A	G	11: 102,354,366	V585A	probably benign	Het
Stk38l	T	A	6: 146,775,686	S461T	probably benign	Het
Tbkbp1	A	T	11: 97,149,469	S40T	probably damaging	Het
Tet1	A	G	10: 62,879,941	M25T	probably benign	Het
Themis	A	G	10: 28,782,011	R192G	probably damaging	Het
Tmem144	T	C	3: 79,825,354	T206A	probably benign	Het
Tmem74b	G	A	2: 151,706,959	R202H	probably damaging	Het
Vars	A	G	17: 35,011,809	H557R	probably benign	Het
Zbtb12	C	A	17: 34,896,301	A354E	possibly damaging	Het
Zfp143	A	T	7: 110,061,117		probably benign	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TTCCCAGCATCAGCGTGTAACTC -3'
(R):5'- TGCCACCCTCTCAGATCAACTGTG -3'

Sequencing Primer
(F):5'- ATCAGCGTGTAACTCTCAGG -3'
(R):5'- CCTCTCAGATCAACTGTGGAATC -3'

Posted On

2013-05-23