Incidental Mutation 'R0445:Trpm1'
ID39317
Institutional Source Beutler Lab
Gene Symbol Trpm1
Ensembl Gene ENSMUSG00000030523
Gene Nametransient receptor potential cation channel, subfamily M, member 1
SynonymsMlsn1, 4732499L03Rik, LTRPC1, melastatin
MMRRC Submission 038646-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0445 (G1)
Quality Score126
Status Validated
Chromosome7
Chromosomal Location64153835-64269775 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 64244842 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206848]
Predicted Effect probably benign
Transcript: ENSMUST00000085222
SMART Domains Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
transmembrane domain 876 895 N/A INTRINSIC
Pfam:Ion_trans 907 1120 6e-16 PFAM
transmembrane domain 1150 1167 N/A INTRINSIC
low complexity region 1216 1225 N/A INTRINSIC
PDB:3E7K|H 1228 1279 1e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000107525
SMART Domains Protein: ENSMUSP00000103149
Gene: ENSMUSG00000030523

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
Pfam:Ion_trans 876 1138 7.6e-22 PFAM
transmembrane domain 1156 1173 N/A INTRINSIC
Pfam:TRPM_tetra 1230 1285 9.4e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206000
Predicted Effect probably benign
Transcript: ENSMUST00000206263
Predicted Effect probably benign
Transcript: ENSMUST00000206277
Predicted Effect probably benign
Transcript: ENSMUST00000206314
Predicted Effect probably benign
Transcript: ENSMUST00000206848
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A C 17: 48,090,022 probably null Het
4932438A13Rik T C 3: 37,000,065 V3111A probably damaging Het
A2m C T 6: 121,657,955 T687I probably damaging Het
Acsbg1 A G 9: 54,615,895 S483P probably damaging Het
Adam22 T A 5: 8,180,591 probably benign Het
Aggf1 A G 13: 95,354,001 V595A possibly damaging Het
Aplf A T 6: 87,663,752 L71I probably damaging Het
Arid3c G T 4: 41,725,172 P292T probably benign Het
Brms1l T A 12: 55,861,406 Y213* probably null Het
C87436 T A 6: 86,449,850 S332T possibly damaging Het
Cad G A 5: 31,072,709 A1454T probably benign Het
Cdkn3 T C 14: 46,767,400 probably null Het
Cnot1 A G 8: 95,760,208 C624R probably damaging Het
Cntnap5c A T 17: 58,104,743 I541F probably benign Het
Cyhr1 T C 15: 76,648,257 H217R probably damaging Het
Dennd1b A G 1: 139,167,765 probably benign Het
Dscam A T 16: 96,772,503 I753N probably damaging Het
Eef2 C CN 10: 81,178,770 probably null Het
Epg5 T A 18: 78,014,184 V1826D possibly damaging Het
Epha8 T C 4: 136,932,400 Y755C probably damaging Het
Esco1 A T 18: 10,574,989 N694K probably damaging Het
Fermt3 T C 19: 7,003,299 H300R probably benign Het
Galnt5 C A 2: 57,998,950 F187L probably benign Het
Gm17067 A G 7: 42,708,622 I152T probably benign Het
Gnb3 T C 6: 124,837,255 D154G possibly damaging Het
Gpr155 G A 2: 73,370,144 probably benign Het
Hdac3 A G 18: 37,943,724 I240T probably damaging Het
Ifitm1 A T 7: 140,968,441 probably null Het
Kif1b A T 4: 149,188,009 L1455Q probably benign Het
Krt1 A C 15: 101,847,621 L388R probably damaging Het
Lrp1 T A 10: 127,590,636 K635* probably null Het
Map3k2 A G 18: 32,217,210 Y371C probably damaging Het
Mcu T C 10: 59,456,645 probably benign Het
Mkrn1 C T 6: 39,404,854 V167I probably benign Het
Mrpl9 T A 3: 94,444,891 probably benign Het
Naip2 T C 13: 100,161,887 Y547C possibly damaging Het
Nup88 G A 11: 70,947,729 T487I probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Obscn C T 11: 58,999,335 R7457H unknown Het
Olfr1383 T A 11: 49,523,957 V78E probably damaging Het
Olfr272 G A 4: 52,910,849 T315M probably benign Het
Paf1 T C 7: 28,395,688 S118P probably damaging Het
Parp4 T A 14: 56,602,748 probably null Het
Pcdh15 A T 10: 74,342,549 Y157F probably damaging Het
Pex10 G A 4: 155,069,074 probably null Het
Phrf1 C T 7: 141,247,331 probably benign Het
Polr3a G T 14: 24,454,921 D1090E probably benign Het
Ppfia4 A C 1: 134,327,289 L276R probably benign Het
Rdh16f1 T C 10: 127,790,867 L263S probably benign Het
Ryr3 T C 2: 112,866,054 D967G probably benign Het
Shc1 G T 3: 89,426,537 A226S probably damaging Het
Slc4a1 A G 11: 102,354,366 V585A probably benign Het
Stk38l T A 6: 146,775,686 S461T probably benign Het
Tbkbp1 A T 11: 97,149,469 S40T probably damaging Het
Tet1 A G 10: 62,879,941 M25T probably benign Het
Themis A G 10: 28,782,011 R192G probably damaging Het
Tmem144 T C 3: 79,825,354 T206A probably benign Het
Tmem74b G A 2: 151,706,959 R202H probably damaging Het
Vars A G 17: 35,011,809 H557R probably benign Het
Zbtb12 C A 17: 34,896,301 A354E possibly damaging Het
Zfp143 A T 7: 110,061,117 probably benign Het
Other mutations in Trpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Trpm1 APN 7 64243450 missense probably damaging 1.00
IGL00465:Trpm1 APN 7 64247467 missense possibly damaging 0.94
IGL01118:Trpm1 APN 7 64235824 missense probably benign 0.24
IGL01148:Trpm1 APN 7 64243564 missense probably damaging 1.00
IGL01303:Trpm1 APN 7 64210830 critical splice acceptor site probably benign 0.00
IGL01432:Trpm1 APN 7 64235019 missense probably benign 0.18
IGL01433:Trpm1 APN 7 64204528 missense probably damaging 1.00
IGL01506:Trpm1 APN 7 64243581 missense probably damaging 1.00
IGL01626:Trpm1 APN 7 64268889 missense probably damaging 1.00
IGL01640:Trpm1 APN 7 64226897 missense probably damaging 1.00
IGL01899:Trpm1 APN 7 64234994 missense probably benign 0.24
IGL01959:Trpm1 APN 7 64208975 missense possibly damaging 0.81
IGL02210:Trpm1 APN 7 64210865 missense probably damaging 1.00
IGL02268:Trpm1 APN 7 64217614 missense probably damaging 0.96
IGL02331:Trpm1 APN 7 64235052 missense probably benign 0.30
IGL02334:Trpm1 APN 7 64245942 critical splice acceptor site probably null
IGL02407:Trpm1 APN 7 64219121 missense probably damaging 1.00
IGL02425:Trpm1 APN 7 64240427 missense probably damaging 0.96
IGL02485:Trpm1 APN 7 64269114 missense possibly damaging 0.52
IGL02635:Trpm1 APN 7 64199224 missense probably benign 0.00
IGL02640:Trpm1 APN 7 64219133 missense probably damaging 0.97
IGL02827:Trpm1 APN 7 64219160 missense probably null 1.00
PIT4458001:Trpm1 UTSW 7 64268561 missense possibly damaging 0.94
PIT4544001:Trpm1 UTSW 7 64199250 intron probably benign
R0012:Trpm1 UTSW 7 64268591 missense possibly damaging 0.88
R0014:Trpm1 UTSW 7 64248222 missense probably damaging 1.00
R0056:Trpm1 UTSW 7 64243586 missense probably damaging 1.00
R0463:Trpm1 UTSW 7 64220254 missense probably benign 0.05
R0469:Trpm1 UTSW 7 64223758 missense probably damaging 1.00
R0510:Trpm1 UTSW 7 64223758 missense probably damaging 1.00
R1301:Trpm1 UTSW 7 64203053 unclassified probably null
R1397:Trpm1 UTSW 7 64217658 missense probably damaging 1.00
R1588:Trpm1 UTSW 7 64223817 missense possibly damaging 0.93
R1618:Trpm1 UTSW 7 64240535 missense probably damaging 1.00
R1724:Trpm1 UTSW 7 64235821 nonsense probably null
R1827:Trpm1 UTSW 7 64235007 missense probably damaging 1.00
R1829:Trpm1 UTSW 7 64226782 missense probably damaging 1.00
R1835:Trpm1 UTSW 7 64230268 missense probably damaging 1.00
R1864:Trpm1 UTSW 7 64268016 missense probably damaging 1.00
R1895:Trpm1 UTSW 7 64223808 missense probably damaging 1.00
R1946:Trpm1 UTSW 7 64223808 missense probably damaging 1.00
R1959:Trpm1 UTSW 7 64230230 missense probably damaging 1.00
R1960:Trpm1 UTSW 7 64230230 missense probably damaging 1.00
R1980:Trpm1 UTSW 7 64208434 missense possibly damaging 0.83
R1989:Trpm1 UTSW 7 64209032 intron probably null
R2054:Trpm1 UTSW 7 64240555 missense possibly damaging 0.69
R2156:Trpm1 UTSW 7 64234988 missense probably damaging 1.00
R2251:Trpm1 UTSW 7 64209976 missense probably damaging 1.00
R3051:Trpm1 UTSW 7 64269101 missense probably damaging 1.00
R3148:Trpm1 UTSW 7 64235012 missense probably benign 0.00
R3195:Trpm1 UTSW 7 64199313 nonsense probably null
R3615:Trpm1 UTSW 7 64243570 missense probably damaging 1.00
R3616:Trpm1 UTSW 7 64243570 missense probably damaging 1.00
R3623:Trpm1 UTSW 7 64244853 missense probably damaging 1.00
R3624:Trpm1 UTSW 7 64244853 missense probably damaging 1.00
R3721:Trpm1 UTSW 7 64217727 intron probably benign
R3822:Trpm1 UTSW 7 64217703 intron probably benign
R4441:Trpm1 UTSW 7 64201918 missense probably damaging 1.00
R4490:Trpm1 UTSW 7 64208912 nonsense probably null
R4666:Trpm1 UTSW 7 64203034 missense probably damaging 1.00
R4701:Trpm1 UTSW 7 64243500 missense probably damaging 1.00
R4781:Trpm1 UTSW 7 64235052 missense probably benign 0.30
R4811:Trpm1 UTSW 7 64208306 missense probably damaging 1.00
R5017:Trpm1 UTSW 7 64244832 unclassified probably benign
R5030:Trpm1 UTSW 7 64235831 missense probably damaging 1.00
R5195:Trpm1 UTSW 7 64237693 missense possibly damaging 0.84
R5238:Trpm1 UTSW 7 64268954 missense probably damaging 1.00
R5304:Trpm1 UTSW 7 64208946 missense probably benign 0.00
R5575:Trpm1 UTSW 7 64220270 missense possibly damaging 0.95
R5613:Trpm1 UTSW 7 64208411 missense probably damaging 1.00
R5855:Trpm1 UTSW 7 64268962 nonsense probably null
R5947:Trpm1 UTSW 7 64223799 missense probably benign 0.07
R5988:Trpm1 UTSW 7 64226805 missense probably benign 0.16
R6054:Trpm1 UTSW 7 64268702 missense probably benign 0.00
R6088:Trpm1 UTSW 7 64267976 missense probably damaging 0.98
R6259:Trpm1 UTSW 7 64268478 missense possibly damaging 0.47
R6379:Trpm1 UTSW 7 64199194 missense probably benign 0.00
R6380:Trpm1 UTSW 7 64268297 missense probably benign 0.24
R6429:Trpm1 UTSW 7 64268504 missense probably benign 0.00
R6600:Trpm1 UTSW 7 64154033 start codon destroyed probably null 0.56
R6622:Trpm1 UTSW 7 64240595 missense probably damaging 0.96
R6939:Trpm1 UTSW 7 64268297 missense probably benign 0.03
R6944:Trpm1 UTSW 7 64243433 missense probably damaging 1.00
R7025:Trpm1 UTSW 7 64226714 critical splice acceptor site probably null
R7112:Trpm1 UTSW 7 64235845 missense probably damaging 0.97
R7168:Trpm1 UTSW 7 64268697 missense probably benign 0.01
R7219:Trpm1 UTSW 7 64204585 missense possibly damaging 0.68
R7224:Trpm1 UTSW 7 64219106 critical splice acceptor site probably null
R7285:Trpm1 UTSW 7 64209981 nonsense probably null
R7367:Trpm1 UTSW 7 64268801 missense probably benign 0.06
R7449:Trpm1 UTSW 7 64208975 missense probably benign 0.14
R7466:Trpm1 UTSW 7 64240582 missense probably damaging 0.99
R7498:Trpm1 UTSW 7 64208909 missense possibly damaging 0.93
R7581:Trpm1 UTSW 7 64204555 missense probably benign 0.00
X0026:Trpm1 UTSW 7 64268910 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTCCCAGCATCAGCGTGTAACTC -3'
(R):5'- TGCCACCCTCTCAGATCAACTGTG -3'

Sequencing Primer
(F):5'- ATCAGCGTGTAACTCTCAGG -3'
(R):5'- CCTCTCAGATCAACTGTGGAATC -3'
Posted On2013-05-23