Incidental Mutation 'R0445:Trpm1'
ID 39317
Institutional Source Beutler Lab
Gene Symbol Trpm1
Ensembl Gene ENSMUSG00000030523
Gene Name transient receptor potential cation channel, subfamily M, member 1
Synonyms Mlsn1, melastatin, 4732499L03Rik, LTRPC1
MMRRC Submission 038646-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0445 (G1)
Quality Score 126
Status Validated
Chromosome 7
Chromosomal Location 63803583-63919523 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 63894590 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206848]
AlphaFold Q2TV84
Predicted Effect probably benign
Transcript: ENSMUST00000085222
SMART Domains Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
transmembrane domain 876 895 N/A INTRINSIC
Pfam:Ion_trans 907 1120 6e-16 PFAM
transmembrane domain 1150 1167 N/A INTRINSIC
low complexity region 1216 1225 N/A INTRINSIC
PDB:3E7K|H 1228 1279 1e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000107525
SMART Domains Protein: ENSMUSP00000103149
Gene: ENSMUSG00000030523

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
Pfam:Ion_trans 876 1138 7.6e-22 PFAM
transmembrane domain 1156 1173 N/A INTRINSIC
Pfam:TRPM_tetra 1230 1285 9.4e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206000
Predicted Effect probably benign
Transcript: ENSMUST00000206263
Predicted Effect probably benign
Transcript: ENSMUST00000206277
Predicted Effect probably benign
Transcript: ENSMUST00000206314
Predicted Effect probably benign
Transcript: ENSMUST00000206848
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A C 17: 48,400,542 (GRCm39) probably null Het
A2m C T 6: 121,634,914 (GRCm39) T687I probably damaging Het
Acsbg1 A G 9: 54,523,179 (GRCm39) S483P probably damaging Het
Adam22 T A 5: 8,230,591 (GRCm39) probably benign Het
Aggf1 A G 13: 95,490,509 (GRCm39) V595A possibly damaging Het
Aplf A T 6: 87,640,734 (GRCm39) L71I probably damaging Het
Arid3c G T 4: 41,725,172 (GRCm39) P292T probably benign Het
Bltp1 T C 3: 37,054,214 (GRCm39) V3111A probably damaging Het
Brms1l T A 12: 55,908,191 (GRCm39) Y213* probably null Het
C87436 T A 6: 86,426,832 (GRCm39) S332T possibly damaging Het
Cad G A 5: 31,230,053 (GRCm39) A1454T probably benign Het
Cdkn3 T C 14: 47,004,857 (GRCm39) probably null Het
Cnot1 A G 8: 96,486,836 (GRCm39) C624R probably damaging Het
Cntnap5c A T 17: 58,411,738 (GRCm39) I541F probably benign Het
Dennd1b A G 1: 139,095,503 (GRCm39) probably benign Het
Dscam A T 16: 96,573,703 (GRCm39) I753N probably damaging Het
Eef2 C CN 10: 81,014,604 (GRCm39) probably null Het
Epg5 T A 18: 78,057,399 (GRCm39) V1826D possibly damaging Het
Epha8 T C 4: 136,659,711 (GRCm39) Y755C probably damaging Het
Esco1 A T 18: 10,574,989 (GRCm39) N694K probably damaging Het
Fermt3 T C 19: 6,980,667 (GRCm39) H300R probably benign Het
Galnt5 C A 2: 57,888,962 (GRCm39) F187L probably benign Het
Gm17067 A G 7: 42,358,046 (GRCm39) I152T probably benign Het
Gnb3 T C 6: 124,814,218 (GRCm39) D154G possibly damaging Het
Gpr155 G A 2: 73,200,488 (GRCm39) probably benign Het
Hdac3 A G 18: 38,076,777 (GRCm39) I240T probably damaging Het
Ifitm1 A T 7: 140,548,354 (GRCm39) probably null Het
Kif1b A T 4: 149,272,466 (GRCm39) L1455Q probably benign Het
Krt1 A C 15: 101,756,056 (GRCm39) L388R probably damaging Het
Lrp1 T A 10: 127,426,505 (GRCm39) K635* probably null Het
Map3k2 A G 18: 32,350,263 (GRCm39) Y371C probably damaging Het
Mcu T C 10: 59,292,467 (GRCm39) probably benign Het
Mkrn1 C T 6: 39,381,788 (GRCm39) V167I probably benign Het
Mrpl9 T A 3: 94,352,198 (GRCm39) probably benign Het
Naip2 T C 13: 100,298,395 (GRCm39) Y547C possibly damaging Het
Nup88 G A 11: 70,838,555 (GRCm39) T487I probably benign Het
Oas3 G A 5: 120,894,210 (GRCm39) R39C probably damaging Het
Obscn C T 11: 58,890,161 (GRCm39) R7457H unknown Het
Or13c25 G A 4: 52,910,849 (GRCm39) T315M probably benign Het
Or2y13 T A 11: 49,414,784 (GRCm39) V78E probably damaging Het
Paf1 T C 7: 28,095,113 (GRCm39) S118P probably damaging Het
Parp4 T A 14: 56,840,205 (GRCm39) probably null Het
Pcdh15 A T 10: 74,178,381 (GRCm39) Y157F probably damaging Het
Pex10 G A 4: 155,153,531 (GRCm39) probably null Het
Phrf1 C T 7: 140,827,244 (GRCm39) probably benign Het
Polr3a G T 14: 24,504,989 (GRCm39) D1090E probably benign Het
Ppfia4 A C 1: 134,255,027 (GRCm39) L276R probably benign Het
Rdh16f1 T C 10: 127,626,736 (GRCm39) L263S probably benign Het
Ryr3 T C 2: 112,696,399 (GRCm39) D967G probably benign Het
Shc1 G T 3: 89,333,844 (GRCm39) A226S probably damaging Het
Slc4a1 A G 11: 102,245,192 (GRCm39) V585A probably benign Het
Stk38l T A 6: 146,677,184 (GRCm39) S461T probably benign Het
Tbkbp1 A T 11: 97,040,295 (GRCm39) S40T probably damaging Het
Tet1 A G 10: 62,715,720 (GRCm39) M25T probably benign Het
Themis A G 10: 28,658,007 (GRCm39) R192G probably damaging Het
Tmem144 T C 3: 79,732,661 (GRCm39) T206A probably benign Het
Tmem74b G A 2: 151,548,879 (GRCm39) R202H probably damaging Het
Vars1 A G 17: 35,230,785 (GRCm39) H557R probably benign Het
Zbtb12 C A 17: 35,115,277 (GRCm39) A354E possibly damaging Het
Zfp143 A T 7: 109,660,324 (GRCm39) probably benign Het
Zftraf1 T C 15: 76,532,457 (GRCm39) H217R probably damaging Het
Other mutations in Trpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Trpm1 APN 7 63,893,198 (GRCm39) missense probably damaging 1.00
IGL00465:Trpm1 APN 7 63,897,215 (GRCm39) missense possibly damaging 0.94
IGL01118:Trpm1 APN 7 63,885,572 (GRCm39) missense probably benign 0.24
IGL01148:Trpm1 APN 7 63,893,312 (GRCm39) missense probably damaging 1.00
IGL01303:Trpm1 APN 7 63,860,578 (GRCm39) critical splice acceptor site probably benign 0.00
IGL01432:Trpm1 APN 7 63,884,767 (GRCm39) missense probably benign 0.18
IGL01433:Trpm1 APN 7 63,854,276 (GRCm39) missense probably damaging 1.00
IGL01506:Trpm1 APN 7 63,893,329 (GRCm39) missense probably damaging 1.00
IGL01626:Trpm1 APN 7 63,918,637 (GRCm39) missense probably damaging 1.00
IGL01640:Trpm1 APN 7 63,876,645 (GRCm39) missense probably damaging 1.00
IGL01899:Trpm1 APN 7 63,884,742 (GRCm39) missense probably benign 0.24
IGL01959:Trpm1 APN 7 63,858,723 (GRCm39) missense possibly damaging 0.81
IGL02210:Trpm1 APN 7 63,860,613 (GRCm39) missense probably damaging 1.00
IGL02268:Trpm1 APN 7 63,867,362 (GRCm39) missense probably damaging 0.96
IGL02331:Trpm1 APN 7 63,884,800 (GRCm39) missense probably benign 0.30
IGL02334:Trpm1 APN 7 63,895,690 (GRCm39) critical splice acceptor site probably null
IGL02407:Trpm1 APN 7 63,868,869 (GRCm39) missense probably damaging 1.00
IGL02425:Trpm1 APN 7 63,890,175 (GRCm39) missense probably damaging 0.96
IGL02485:Trpm1 APN 7 63,918,862 (GRCm39) missense possibly damaging 0.52
IGL02635:Trpm1 APN 7 63,848,972 (GRCm39) missense probably benign 0.00
IGL02640:Trpm1 APN 7 63,868,881 (GRCm39) missense probably damaging 0.97
IGL02827:Trpm1 APN 7 63,868,908 (GRCm39) missense probably null 1.00
PIT4458001:Trpm1 UTSW 7 63,918,309 (GRCm39) missense possibly damaging 0.94
PIT4544001:Trpm1 UTSW 7 63,848,998 (GRCm39) intron probably benign
R0012:Trpm1 UTSW 7 63,918,339 (GRCm39) missense possibly damaging 0.88
R0014:Trpm1 UTSW 7 63,897,970 (GRCm39) missense probably damaging 1.00
R0056:Trpm1 UTSW 7 63,893,334 (GRCm39) missense probably damaging 1.00
R0463:Trpm1 UTSW 7 63,870,002 (GRCm39) missense probably benign 0.05
R0469:Trpm1 UTSW 7 63,873,506 (GRCm39) missense probably damaging 1.00
R0510:Trpm1 UTSW 7 63,873,506 (GRCm39) missense probably damaging 1.00
R1301:Trpm1 UTSW 7 63,852,801 (GRCm39) splice site probably null
R1397:Trpm1 UTSW 7 63,867,406 (GRCm39) missense probably damaging 1.00
R1588:Trpm1 UTSW 7 63,873,565 (GRCm39) missense possibly damaging 0.93
R1618:Trpm1 UTSW 7 63,890,283 (GRCm39) missense probably damaging 1.00
R1724:Trpm1 UTSW 7 63,885,569 (GRCm39) nonsense probably null
R1827:Trpm1 UTSW 7 63,884,755 (GRCm39) missense probably damaging 1.00
R1829:Trpm1 UTSW 7 63,876,530 (GRCm39) missense probably damaging 1.00
R1835:Trpm1 UTSW 7 63,880,016 (GRCm39) missense probably damaging 1.00
R1864:Trpm1 UTSW 7 63,917,764 (GRCm39) missense probably damaging 1.00
R1895:Trpm1 UTSW 7 63,873,556 (GRCm39) missense probably damaging 1.00
R1946:Trpm1 UTSW 7 63,873,556 (GRCm39) missense probably damaging 1.00
R1959:Trpm1 UTSW 7 63,879,978 (GRCm39) missense probably damaging 1.00
R1960:Trpm1 UTSW 7 63,879,978 (GRCm39) missense probably damaging 1.00
R1980:Trpm1 UTSW 7 63,858,182 (GRCm39) missense possibly damaging 0.83
R1989:Trpm1 UTSW 7 63,858,780 (GRCm39) intron probably null
R2054:Trpm1 UTSW 7 63,890,303 (GRCm39) missense possibly damaging 0.69
R2156:Trpm1 UTSW 7 63,884,736 (GRCm39) missense probably damaging 1.00
R2251:Trpm1 UTSW 7 63,859,724 (GRCm39) missense probably damaging 1.00
R3051:Trpm1 UTSW 7 63,918,849 (GRCm39) missense probably damaging 1.00
R3148:Trpm1 UTSW 7 63,884,760 (GRCm39) missense probably benign 0.00
R3195:Trpm1 UTSW 7 63,849,061 (GRCm39) nonsense probably null
R3615:Trpm1 UTSW 7 63,893,318 (GRCm39) missense probably damaging 1.00
R3616:Trpm1 UTSW 7 63,893,318 (GRCm39) missense probably damaging 1.00
R3623:Trpm1 UTSW 7 63,894,601 (GRCm39) missense probably damaging 1.00
R3624:Trpm1 UTSW 7 63,894,601 (GRCm39) missense probably damaging 1.00
R3721:Trpm1 UTSW 7 63,867,475 (GRCm39) intron probably benign
R3822:Trpm1 UTSW 7 63,867,451 (GRCm39) intron probably benign
R4441:Trpm1 UTSW 7 63,851,666 (GRCm39) missense probably damaging 1.00
R4490:Trpm1 UTSW 7 63,858,660 (GRCm39) nonsense probably null
R4666:Trpm1 UTSW 7 63,852,782 (GRCm39) missense probably damaging 1.00
R4701:Trpm1 UTSW 7 63,893,248 (GRCm39) missense probably damaging 1.00
R4781:Trpm1 UTSW 7 63,884,800 (GRCm39) missense probably benign 0.30
R4811:Trpm1 UTSW 7 63,858,054 (GRCm39) missense probably damaging 1.00
R5017:Trpm1 UTSW 7 63,894,580 (GRCm39) unclassified probably benign
R5030:Trpm1 UTSW 7 63,885,579 (GRCm39) missense probably damaging 1.00
R5195:Trpm1 UTSW 7 63,887,441 (GRCm39) missense possibly damaging 0.84
R5238:Trpm1 UTSW 7 63,918,702 (GRCm39) missense probably damaging 1.00
R5304:Trpm1 UTSW 7 63,858,694 (GRCm39) missense probably benign 0.00
R5575:Trpm1 UTSW 7 63,870,018 (GRCm39) missense possibly damaging 0.95
R5613:Trpm1 UTSW 7 63,858,159 (GRCm39) missense probably damaging 1.00
R5855:Trpm1 UTSW 7 63,918,710 (GRCm39) nonsense probably null
R5947:Trpm1 UTSW 7 63,873,547 (GRCm39) missense probably benign 0.07
R5988:Trpm1 UTSW 7 63,876,553 (GRCm39) missense probably benign 0.16
R6054:Trpm1 UTSW 7 63,918,450 (GRCm39) missense probably benign 0.00
R6088:Trpm1 UTSW 7 63,917,724 (GRCm39) missense probably damaging 0.98
R6259:Trpm1 UTSW 7 63,918,226 (GRCm39) missense possibly damaging 0.47
R6379:Trpm1 UTSW 7 63,848,942 (GRCm39) missense probably benign 0.00
R6380:Trpm1 UTSW 7 63,918,045 (GRCm39) missense probably benign 0.24
R6429:Trpm1 UTSW 7 63,918,252 (GRCm39) missense probably benign 0.00
R6600:Trpm1 UTSW 7 63,803,781 (GRCm39) start codon destroyed probably null 0.56
R6622:Trpm1 UTSW 7 63,890,343 (GRCm39) missense probably damaging 0.96
R6939:Trpm1 UTSW 7 63,918,045 (GRCm39) missense probably benign 0.03
R6944:Trpm1 UTSW 7 63,893,181 (GRCm39) missense probably damaging 1.00
R7025:Trpm1 UTSW 7 63,876,462 (GRCm39) critical splice acceptor site probably null
R7112:Trpm1 UTSW 7 63,885,593 (GRCm39) missense probably damaging 0.97
R7168:Trpm1 UTSW 7 63,918,445 (GRCm39) missense probably benign 0.01
R7219:Trpm1 UTSW 7 63,854,333 (GRCm39) missense possibly damaging 0.68
R7224:Trpm1 UTSW 7 63,868,854 (GRCm39) critical splice acceptor site probably null
R7285:Trpm1 UTSW 7 63,859,729 (GRCm39) nonsense probably null
R7367:Trpm1 UTSW 7 63,918,549 (GRCm39) missense probably benign 0.06
R7449:Trpm1 UTSW 7 63,858,723 (GRCm39) missense probably benign 0.14
R7466:Trpm1 UTSW 7 63,890,330 (GRCm39) missense probably damaging 0.99
R7498:Trpm1 UTSW 7 63,858,657 (GRCm39) missense possibly damaging 0.93
R7581:Trpm1 UTSW 7 63,854,303 (GRCm39) missense probably benign 0.00
R7776:Trpm1 UTSW 7 63,897,939 (GRCm39) missense probably benign 0.04
R8062:Trpm1 UTSW 7 63,851,689 (GRCm39) missense probably benign 0.18
R8069:Trpm1 UTSW 7 63,858,718 (GRCm39) missense possibly damaging 0.55
R8157:Trpm1 UTSW 7 63,849,017 (GRCm39) missense probably damaging 1.00
R8219:Trpm1 UTSW 7 63,851,699 (GRCm39) missense probably benign 0.35
R8258:Trpm1 UTSW 7 63,918,777 (GRCm39) missense probably benign 0.10
R8259:Trpm1 UTSW 7 63,918,777 (GRCm39) missense probably benign 0.10
R8320:Trpm1 UTSW 7 63,918,541 (GRCm39) missense possibly damaging 0.56
R8536:Trpm1 UTSW 7 63,897,155 (GRCm39) missense probably damaging 1.00
R8544:Trpm1 UTSW 7 63,874,356 (GRCm39) splice site probably null
R8813:Trpm1 UTSW 7 63,851,756 (GRCm39) missense possibly damaging 0.68
R8912:Trpm1 UTSW 7 63,918,628 (GRCm39) missense probably benign 0.06
R8954:Trpm1 UTSW 7 63,858,089 (GRCm39) missense probably damaging 0.98
R9139:Trpm1 UTSW 7 63,848,943 (GRCm39) missense probably benign 0.00
R9205:Trpm1 UTSW 7 63,890,319 (GRCm39) missense possibly damaging 0.66
R9258:Trpm1 UTSW 7 63,884,713 (GRCm39) missense probably benign 0.01
R9283:Trpm1 UTSW 7 63,873,623 (GRCm39) missense probably benign 0.18
R9394:Trpm1 UTSW 7 63,918,480 (GRCm39) missense probably benign 0.00
R9430:Trpm1 UTSW 7 63,873,446 (GRCm39) missense probably benign 0.38
R9537:Trpm1 UTSW 7 63,803,616 (GRCm39) unclassified probably benign
R9616:Trpm1 UTSW 7 63,858,132 (GRCm39) missense probably damaging 0.99
R9774:Trpm1 UTSW 7 63,898,041 (GRCm39) missense possibly damaging 0.90
X0026:Trpm1 UTSW 7 63,918,658 (GRCm39) missense probably benign 0.05
Z1176:Trpm1 UTSW 7 63,854,342 (GRCm39) critical splice donor site probably null
Z1176:Trpm1 UTSW 7 63,852,879 (GRCm39) critical splice donor site probably null
Z1177:Trpm1 UTSW 7 63,867,439 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TTCCCAGCATCAGCGTGTAACTC -3'
(R):5'- TGCCACCCTCTCAGATCAACTGTG -3'

Sequencing Primer
(F):5'- ATCAGCGTGTAACTCTCAGG -3'
(R):5'- CCTCTCAGATCAACTGTGGAATC -3'
Posted On 2013-05-23