Incidental Mutation 'R5040:Abcc6'
ID 393170
Institutional Source Beutler Lab
Gene Symbol Abcc6
Ensembl Gene ENSMUSG00000030834
Gene Name ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Synonyms Mrp6, DCC, Dyscalc1
MMRRC Submission 042630-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.692) question?
Stock # R5040 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 45967555-46030302 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46020154 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 159 (Q159R)
Ref Sequence ENSEMBL: ENSMUSP00000002850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002850]
AlphaFold Q9R1S7
Predicted Effect probably benign
Transcript: ENSMUST00000002850
AA Change: Q159R

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: Q159R

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
transmembrane domain 81 100 N/A INTRINSIC
transmembrane domain 110 129 N/A INTRINSIC
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ABC_membrane 309 580 3.5e-29 PFAM
AAA 653 828 1.19e-9 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:ABC_membrane 942 1211 2.5e-32 PFAM
AAA 1286 1473 1.71e-10 SMART
Meta Mutation Damage Score 0.1114 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,475,001 D284V probably damaging Het
AF067063 C T 13: 119,828,489 W57* probably null Het
Ap2a1 T C 7: 44,905,804 I446V possibly damaging Het
Areg A T 5: 91,144,339 H166L possibly damaging Het
Arhgap15 T C 2: 43,844,813 probably null Het
Arhgef17 T C 7: 100,876,825 D874G probably benign Het
Cast T C 13: 74,724,813 T452A probably damaging Het
Ccdc154 A T 17: 25,164,592 T208S probably benign Het
Chst11 T A 10: 83,190,946 L69Q probably benign Het
Clec2d G A 6: 129,184,830 R142K probably damaging Het
Dis3l2 A T 1: 86,857,337 I303F probably damaging Het
Dusp27 G A 1: 166,100,345 T566I probably benign Het
Dync2h1 A G 9: 6,992,625 Y3979H probably benign Het
Ehmt1 A T 2: 24,884,304 C162S probably benign Het
Eif4g3 G T 4: 138,096,889 M239I probably damaging Het
Eif5 A G 12: 111,539,850 D41G probably damaging Het
Fat1 C T 8: 45,023,380 A1821V probably damaging Het
Fry G A 5: 150,388,854 A745T probably damaging Het
Galnt9 T C 5: 110,617,905 L491P probably damaging Het
Gata3 A G 2: 9,858,515 L396P probably damaging Het
Grasp G A 15: 101,229,042 V134I probably damaging Het
Gyg A G 3: 20,122,659 probably benign Het
Hhip C A 8: 79,997,606 V336L probably benign Het
Hipk2 G A 6: 38,730,881 P660S possibly damaging Het
Hnrnpul1 G A 7: 25,742,989 T276I possibly damaging Het
Ifnl2 G T 7: 28,509,086 R147S possibly damaging Het
Ilvbl A G 10: 78,583,318 D467G probably damaging Het
Kcnh1 A T 1: 192,505,475 H748L probably benign Het
Lyg1 A C 1: 37,950,811 probably benign Het
Mak A G 13: 41,030,098 Y544H possibly damaging Het
Med1 A G 11: 98,155,404 probably benign Het
Mogat2 T C 7: 99,238,517 T17A possibly damaging Het
Myom3 T C 4: 135,789,659 S847P probably damaging Het
Nprl2 T G 9: 107,542,400 C9G probably null Het
Olfr1456-ps1 T A 19: 13,078,943 noncoding transcript Het
Pcmtd1 T C 1: 7,120,375 Y23H probably damaging Het
Pkd1 C A 17: 24,571,260 H972Q probably benign Het
Rbm26 A G 14: 105,121,016 I929T probably benign Het
Scrn2 A G 11: 97,030,883 T60A probably damaging Het
Setdb2 A T 14: 59,415,707 I398N probably damaging Het
Setx A G 2: 29,139,338 E206G probably damaging Het
Sez6 T C 11: 77,969,089 probably null Het
Sh3bp4 C T 1: 89,144,240 S270L probably damaging Het
Stac3 T C 10: 127,508,124 I297T probably damaging Het
Supv3l1 A T 10: 62,447,065 V139E possibly damaging Het
Syce1 A T 7: 140,779,065 H178Q probably damaging Het
Tcp10c T A 17: 13,368,191 M344K possibly damaging Het
Tmc1 A G 19: 20,824,030 V502A possibly damaging Het
Tmco4 G T 4: 139,020,166 G242V probably damaging Het
Trp53bp2 G A 1: 182,444,706 R460H probably damaging Het
Virma T A 4: 11,528,746 C1328S probably benign Het
Zfp366 A G 13: 99,228,367 D12G probably damaging Het
Zfp457 C T 13: 67,292,835 A463T probably benign Het
Other mutations in Abcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Abcc6 APN 7 46002672 splice site probably benign
IGL01731:Abcc6 APN 7 46002610 missense possibly damaging 0.71
IGL01743:Abcc6 APN 7 45996814 missense probably benign 0.02
IGL01757:Abcc6 APN 7 45990281 splice site probably benign
IGL01895:Abcc6 APN 7 46029058 missense possibly damaging 0.88
IGL01942:Abcc6 APN 7 45986573 missense possibly damaging 0.89
IGL02251:Abcc6 APN 7 45977416 missense probably damaging 1.00
IGL02277:Abcc6 APN 7 46001061 missense probably benign 0.00
IGL02548:Abcc6 APN 7 46005262 missense probably damaging 0.98
IGL03063:Abcc6 APN 7 46016432 missense probably benign
IGL03092:Abcc6 APN 7 45986470 missense probably damaging 1.00
IGL03251:Abcc6 APN 7 45982237 unclassified probably benign
R0057:Abcc6 UTSW 7 46020143 missense probably benign 0.03
R0944:Abcc6 UTSW 7 46015505 missense possibly damaging 0.81
R1019:Abcc6 UTSW 7 46014107 missense possibly damaging 0.77
R1183:Abcc6 UTSW 7 45985253 missense probably damaging 0.99
R1543:Abcc6 UTSW 7 46016504 missense probably benign 0.01
R1550:Abcc6 UTSW 7 46005244 missense probably benign 0.25
R1725:Abcc6 UTSW 7 45992357 missense possibly damaging 0.76
R1907:Abcc6 UTSW 7 46014169 missense probably benign 0.04
R1908:Abcc6 UTSW 7 46020134 splice site probably null
R1909:Abcc6 UTSW 7 46020134 splice site probably null
R2138:Abcc6 UTSW 7 45981051 missense probably damaging 1.00
R2145:Abcc6 UTSW 7 45998741 missense probably benign 0.01
R2402:Abcc6 UTSW 7 46015575 missense probably benign 0.04
R3983:Abcc6 UTSW 7 45995289 missense probably benign
R4013:Abcc6 UTSW 7 46018680 missense probably benign 0.01
R4051:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4052:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4208:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4362:Abcc6 UTSW 7 45998832 splice site probably benign
R4385:Abcc6 UTSW 7 45995328 missense possibly damaging 0.93
R4399:Abcc6 UTSW 7 46002607 missense probably benign
R4479:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4480:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4780:Abcc6 UTSW 7 45996691 missense probably benign
R4791:Abcc6 UTSW 7 45982160 missense probably benign 0.00
R4895:Abcc6 UTSW 7 45980990 missense possibly damaging 0.95
R4898:Abcc6 UTSW 7 45989687 missense probably damaging 0.96
R4905:Abcc6 UTSW 7 45995225 missense probably benign
R4941:Abcc6 UTSW 7 46012523 missense probably benign 0.00
R5128:Abcc6 UTSW 7 45989646 missense probably benign 0.00
R5284:Abcc6 UTSW 7 45981059 missense probably benign 0.05
R5328:Abcc6 UTSW 7 45992311 missense probably benign 0.01
R5459:Abcc6 UTSW 7 45982183 missense probably benign 0.00
R5543:Abcc6 UTSW 7 45989536 critical splice donor site probably null
R6178:Abcc6 UTSW 7 46029044 missense probably benign
R6228:Abcc6 UTSW 7 46030256 missense probably benign 0.02
R6532:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R6605:Abcc6 UTSW 7 45981057 missense probably damaging 1.00
R7000:Abcc6 UTSW 7 46005522 missense possibly damaging 0.60
R7067:Abcc6 UTSW 7 46018690 missense probably benign
R7553:Abcc6 UTSW 7 45999121 missense probably damaging 1.00
R7597:Abcc6 UTSW 7 45995237 missense probably damaging 1.00
R7718:Abcc6 UTSW 7 45977392 missense possibly damaging 0.91
R7781:Abcc6 UTSW 7 46005606 missense probably damaging 1.00
R7798:Abcc6 UTSW 7 45976853 nonsense probably null
R7896:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R8098:Abcc6 UTSW 7 45996665 missense probably damaging 1.00
R8443:Abcc6 UTSW 7 45980025 missense probably damaging 1.00
R8773:Abcc6 UTSW 7 45985145 missense probably benign
R8784:Abcc6 UTSW 7 46002601 missense probably benign
R8802:Abcc6 UTSW 7 46008859 missense probably damaging 0.99
R8807:Abcc6 UTSW 7 45999007 missense possibly damaging 0.67
R9006:Abcc6 UTSW 7 46016396 missense probably benign 0.00
R9127:Abcc6 UTSW 7 45979760 missense probably damaging 1.00
X0065:Abcc6 UTSW 7 46020197 missense probably damaging 0.99
Z1176:Abcc6 UTSW 7 45979734 missense probably damaging 1.00
Z1176:Abcc6 UTSW 7 45992306 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTGGCCTCTGCACACATAG -3'
(R):5'- AGCCTGGCTTGCTCCAATAG -3'

Sequencing Primer
(F):5'- TCTGCACACATAGCCGTG -3'
(R):5'- CAATAGCTGCTTTCCTGTAGC -3'
Posted On 2016-06-15