Incidental Mutation 'R5040:Zfp457'
ID393185
Institutional Source Beutler Lab
Gene Symbol Zfp457
Ensembl Gene ENSMUSG00000055341
Gene Namezinc finger protein 457
SynonymsRslcan-6
MMRRC Submission 042630-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R5040 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location67288138-67306485 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 67292835 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 463 (A463T)
Ref Sequence ENSEMBL: ENSMUSP00000153220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049705] [ENSMUST00000224325]
Predicted Effect probably benign
Transcript: ENSMUST00000049705
AA Change: A559T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000053879
Gene: ENSMUSG00000055341
AA Change: A559T

DomainStartEndE-ValueType
KRAB 5 65 1.55e-29 SMART
ZnF_C2H2 81 103 2.75e-3 SMART
ZnF_C2H2 109 131 1.1e-2 SMART
ZnF_C2H2 165 187 3.63e-3 SMART
ZnF_C2H2 193 215 2.4e-3 SMART
ZnF_C2H2 221 243 1.12e-3 SMART
ZnF_C2H2 249 271 6.32e-3 SMART
ZnF_C2H2 277 299 6.32e-3 SMART
ZnF_C2H2 305 327 3.52e-1 SMART
ZnF_C2H2 333 355 3.89e-3 SMART
ZnF_C2H2 361 383 7.26e-3 SMART
ZnF_C2H2 389 411 1.2e-3 SMART
ZnF_C2H2 417 439 7.67e-2 SMART
ZnF_C2H2 445 467 1.05e1 SMART
ZnF_C2H2 473 495 3.11e-2 SMART
ZnF_C2H2 501 523 5.9e-3 SMART
ZnF_C2H2 529 551 9.08e-4 SMART
ZnF_C2H2 585 607 5.72e-1 SMART
transmembrane domain 624 646 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224325
AA Change: A463T

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225090
Predicted Effect probably benign
Transcript: ENSMUST00000225338
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,475,001 D284V probably damaging Het
Abcc6 T C 7: 46,020,154 Q159R probably benign Het
AF067063 C T 13: 119,828,489 W57* probably null Het
Ap2a1 T C 7: 44,905,804 I446V possibly damaging Het
Areg A T 5: 91,144,339 H166L possibly damaging Het
Arhgap15 T C 2: 43,844,813 probably null Het
Arhgef17 T C 7: 100,876,825 D874G probably benign Het
Cast T C 13: 74,724,813 T452A probably damaging Het
Ccdc154 A T 17: 25,164,592 T208S probably benign Het
Chst11 T A 10: 83,190,946 L69Q probably benign Het
Clec2d G A 6: 129,184,830 R142K probably damaging Het
Dis3l2 A T 1: 86,857,337 I303F probably damaging Het
Dusp27 G A 1: 166,100,345 T566I probably benign Het
Dync2h1 A G 9: 6,992,625 Y3979H probably benign Het
Ehmt1 A T 2: 24,884,304 C162S probably benign Het
Eif4g3 G T 4: 138,096,889 M239I probably damaging Het
Eif5 A G 12: 111,539,850 D41G probably damaging Het
Fat1 C T 8: 45,023,380 A1821V probably damaging Het
Fry G A 5: 150,388,854 A745T probably damaging Het
Galnt9 T C 5: 110,617,905 L491P probably damaging Het
Gata3 A G 2: 9,858,515 L396P probably damaging Het
Grasp G A 15: 101,229,042 V134I probably damaging Het
Gyg A G 3: 20,122,659 probably benign Het
Hhip C A 8: 79,997,606 V336L probably benign Het
Hipk2 G A 6: 38,730,881 P660S possibly damaging Het
Hnrnpul1 G A 7: 25,742,989 T276I possibly damaging Het
Ifnl2 G T 7: 28,509,086 R147S possibly damaging Het
Ilvbl A G 10: 78,583,318 D467G probably damaging Het
Kcnh1 A T 1: 192,505,475 H748L probably benign Het
Lyg1 A C 1: 37,950,811 probably benign Het
Mak A G 13: 41,030,098 Y544H possibly damaging Het
Med1 A G 11: 98,155,404 probably benign Het
Mogat2 T C 7: 99,238,517 T17A possibly damaging Het
Myom3 T C 4: 135,789,659 S847P probably damaging Het
Nprl2 T G 9: 107,542,400 C9G probably null Het
Olfr1456-ps1 T A 19: 13,078,943 noncoding transcript Het
Pcmtd1 T C 1: 7,120,375 Y23H probably damaging Het
Pkd1 C A 17: 24,571,260 H972Q probably benign Het
Rbm26 A G 14: 105,121,016 I929T probably benign Het
Scrn2 A G 11: 97,030,883 T60A probably damaging Het
Setdb2 A T 14: 59,415,707 I398N probably damaging Het
Setx A G 2: 29,139,338 E206G probably damaging Het
Sez6 T C 11: 77,969,089 probably null Het
Sh3bp4 C T 1: 89,144,240 S270L probably damaging Het
Stac3 T C 10: 127,508,124 I297T probably damaging Het
Supv3l1 A T 10: 62,447,065 V139E possibly damaging Het
Syce1 A T 7: 140,779,065 H178Q probably damaging Het
Tcp10c T A 17: 13,368,191 M344K possibly damaging Het
Tmc1 A G 19: 20,824,030 V502A possibly damaging Het
Tmco4 G T 4: 139,020,166 G242V probably damaging Het
Trp53bp2 G A 1: 182,444,706 R460H probably damaging Het
Virma T A 4: 11,528,746 C1328S probably benign Het
Zfp366 A G 13: 99,228,367 D12G probably damaging Het
Other mutations in Zfp457
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Zfp457 APN 13 67294266 missense possibly damaging 0.46
IGL02259:Zfp457 APN 13 67296407 missense possibly damaging 0.88
R0055:Zfp457 UTSW 13 67294034 missense probably damaging 0.99
R0055:Zfp457 UTSW 13 67294034 missense probably damaging 0.99
R0149:Zfp457 UTSW 13 67292646 missense probably damaging 0.97
R0211:Zfp457 UTSW 13 67293147 missense probably benign 0.01
R0211:Zfp457 UTSW 13 67293147 missense probably benign 0.01
R0230:Zfp457 UTSW 13 67294116 missense possibly damaging 0.91
R0270:Zfp457 UTSW 13 67293927 missense probably damaging 1.00
R0361:Zfp457 UTSW 13 67292646 missense probably damaging 0.97
R0561:Zfp457 UTSW 13 67294070 missense probably damaging 1.00
R0679:Zfp457 UTSW 13 67293591 missense probably damaging 1.00
R0826:Zfp457 UTSW 13 67293314 missense possibly damaging 0.85
R1136:Zfp457 UTSW 13 67293782 missense probably damaging 1.00
R1175:Zfp457 UTSW 13 67293684 missense probably damaging 1.00
R1523:Zfp457 UTSW 13 67293437 missense probably damaging 1.00
R1616:Zfp457 UTSW 13 67296311 missense possibly damaging 0.95
R2348:Zfp457 UTSW 13 67293404 missense probably benign 0.33
R4930:Zfp457 UTSW 13 67294100 missense probably damaging 1.00
R4964:Zfp457 UTSW 13 67293278 missense probably damaging 1.00
R4966:Zfp457 UTSW 13 67293278 missense probably damaging 1.00
R5129:Zfp457 UTSW 13 67293356 missense probably benign 0.00
R5714:Zfp457 UTSW 13 67296426 missense possibly damaging 0.85
R6017:Zfp457 UTSW 13 67293699 missense probably damaging 1.00
R6052:Zfp457 UTSW 13 67293951 missense probably damaging 1.00
R6132:Zfp457 UTSW 13 67293296 nonsense probably null
R6184:Zfp457 UTSW 13 67292912 missense possibly damaging 0.89
R6313:Zfp457 UTSW 13 67292682 missense probably damaging 1.00
R7038:Zfp457 UTSW 13 67293933 missense probably benign 0.00
R7170:Zfp457 UTSW 13 67294177 nonsense probably null
R7184:Zfp457 UTSW 13 67294001 missense possibly damaging 0.69
R7859:Zfp457 UTSW 13 67306381 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCTTGCCACATATTTCACACTTGTA -3'
(R):5'- TATGTGGAAAGGCCTTCTGTT -3'

Sequencing Primer
(F):5'- ACACTTGTAGGGTTTTTCTCCAG -3'
(R):5'- CCCTACAAGTGTGACATATGTGGC -3'
Posted On2016-06-15