Mutagenetix > Incidental Mutation

Incidental Mutation 'R5040:Setdb2'

393189

Institutional Source

Beutler Lab

Gene Symbol

Setdb2

Ensembl Gene

ENSMUSG00000071350

Gene Name

SET domain, bifurcated 2

Synonyms

KMT1F, LOC239122

MMRRC Submission

042630-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.510) question?

Stock #

R5040 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59402009-59440884 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 59415707 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 398 (I398N)

Ref Sequence

ENSEMBL: ENSMUSP00000093450 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000161459]

AlphaFold

Q8C267

Predicted Effect

probably damaging
Transcript: ENSMUST00000095775
AA Change: I398N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: I398N

Domain	Start	End	E-Value	Type
Pfam:MBD	164	236	3.4e-10	PFAM
Pfam:Pre-SET	250	362	1.7e-17	PFAM
SET	370	694	9.33e-32	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161459
AA Change: I382N

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: I382N

Domain	Start	End	E-Value	Type
Pfam:MBD	148	220	2.7e-9	PFAM
Pfam:Pre-SET	233	346	1.3e-19	PFAM
SET	354	678	9.33e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161959

Meta Mutation Damage Score

0.5202

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.2%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	T	A	3: 108,475,001	D284V	probably damaging	Het
Abcc6	T	C	7: 46,020,154	Q159R	probably benign	Het
AF067063	C	T	13: 119,828,489	W57*	probably null	Het
Ap2a1	T	C	7: 44,905,804	I446V	possibly damaging	Het
Areg	A	T	5: 91,144,339	H166L	possibly damaging	Het
Arhgap15	T	C	2: 43,844,813		probably null	Het
Arhgef17	T	C	7: 100,876,825	D874G	probably benign	Het
Cast	T	C	13: 74,724,813	T452A	probably damaging	Het
Ccdc154	A	T	17: 25,164,592	T208S	probably benign	Het
Chst11	T	A	10: 83,190,946	L69Q	probably benign	Het
Clec2d	G	A	6: 129,184,830	R142K	probably damaging	Het
Dis3l2	A	T	1: 86,857,337	I303F	probably damaging	Het
Dusp27	G	A	1: 166,100,345	T566I	probably benign	Het
Dync2h1	A	G	9: 6,992,625	Y3979H	probably benign	Het
Ehmt1	A	T	2: 24,884,304	C162S	probably benign	Het
Eif4g3	G	T	4: 138,096,889	M239I	probably damaging	Het
Eif5	A	G	12: 111,539,850	D41G	probably damaging	Het
Fat1	C	T	8: 45,023,380	A1821V	probably damaging	Het
Fry	G	A	5: 150,388,854	A745T	probably damaging	Het
Galnt9	T	C	5: 110,617,905	L491P	probably damaging	Het
Gata3	A	G	2: 9,858,515	L396P	probably damaging	Het
Grasp	G	A	15: 101,229,042	V134I	probably damaging	Het
Gyg	A	G	3: 20,122,659		probably benign	Het
Hhip	C	A	8: 79,997,606	V336L	probably benign	Het
Hipk2	G	A	6: 38,730,881	P660S	possibly damaging	Het
Hnrnpul1	G	A	7: 25,742,989	T276I	possibly damaging	Het
Ifnl2	G	T	7: 28,509,086	R147S	possibly damaging	Het
Ilvbl	A	G	10: 78,583,318	D467G	probably damaging	Het
Kcnh1	A	T	1: 192,505,475	H748L	probably benign	Het
Lyg1	A	C	1: 37,950,811		probably benign	Het
Mak	A	G	13: 41,030,098	Y544H	possibly damaging	Het
Med1	A	G	11: 98,155,404		probably benign	Het
Mogat2	T	C	7: 99,238,517	T17A	possibly damaging	Het
Myom3	T	C	4: 135,789,659	S847P	probably damaging	Het
Nprl2	T	G	9: 107,542,400	C9G	probably null	Het
Olfr1456-ps1	T	A	19: 13,078,943		noncoding transcript	Het
Pcmtd1	T	C	1: 7,120,375	Y23H	probably damaging	Het
Pkd1	C	A	17: 24,571,260	H972Q	probably benign	Het
Rbm26	A	G	14: 105,121,016	I929T	probably benign	Het
Scrn2	A	G	11: 97,030,883	T60A	probably damaging	Het
Setx	A	G	2: 29,139,338	E206G	probably damaging	Het
Sez6	T	C	11: 77,969,089		probably null	Het
Sh3bp4	C	T	1: 89,144,240	S270L	probably damaging	Het
Stac3	T	C	10: 127,508,124	I297T	probably damaging	Het
Supv3l1	A	T	10: 62,447,065	V139E	possibly damaging	Het
Syce1	A	T	7: 140,779,065	H178Q	probably damaging	Het
Tcp10c	T	A	17: 13,368,191	M344K	possibly damaging	Het
Tmc1	A	G	19: 20,824,030	V502A	possibly damaging	Het
Tmco4	G	T	4: 139,020,166	G242V	probably damaging	Het
Trp53bp2	G	A	1: 182,444,706	R460H	probably damaging	Het
Virma	T	A	4: 11,528,746	C1328S	probably benign	Het
Zfp366	A	G	13: 99,228,367	D12G	probably damaging	Het
Zfp457	C	T	13: 67,292,835	A463T	probably benign	Het

Other mutations in Setdb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Setdb2	APN	14	59415792	missense	probably damaging	1.00
IGL01695:Setdb2	APN	14	59402293	utr 3 prime	probably benign
IGL01720:Setdb2	APN	14	59423436	missense	possibly damaging	0.76
IGL02003:Setdb2	APN	14	59413490	missense	probably damaging	0.98
IGL02023:Setdb2	APN	14	59431158	missense	probably damaging	1.00
IGL02108:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02113:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02114:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02115:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02116:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02117:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02141:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02148:Setdb2	APN	14	59402315	missense	probably damaging	1.00
R0419:Setdb2	UTSW	14	59406744	splice site	probably null
R0610:Setdb2	UTSW	14	59417470	missense	possibly damaging	0.55
R0636:Setdb2	UTSW	14	59406704	missense	probably benign	0.40
R0890:Setdb2	UTSW	14	59419220	missense	possibly damaging	0.89
R0931:Setdb2	UTSW	14	59423496	splice site	probably benign
R1355:Setdb2	UTSW	14	59417441	missense	probably damaging	1.00
R1553:Setdb2	UTSW	14	59417485	missense	probably benign	0.04
R1968:Setdb2	UTSW	14	59419409	missense	probably damaging	1.00
R2472:Setdb2	UTSW	14	59419454	missense	possibly damaging	0.49
R2894:Setdb2	UTSW	14	59426467	missense	probably benign	0.00
R3919:Setdb2	UTSW	14	59419167	missense	probably damaging	1.00
R4609:Setdb2	UTSW	14	59415704	missense	probably damaging	1.00
R4629:Setdb2	UTSW	14	59409359	missense	probably benign	0.13
R4816:Setdb2	UTSW	14	59413646	missense	probably benign	0.05
R4864:Setdb2	UTSW	14	59409266	missense	probably benign	0.01
R4951:Setdb2	UTSW	14	59402303	missense	possibly damaging	0.72
R5245:Setdb2	UTSW	14	59426494	missense	probably null	0.00
R5358:Setdb2	UTSW	14	59409436	missense	probably benign	0.17
R5656:Setdb2	UTSW	14	59419118	missense	probably damaging	1.00
R5705:Setdb2	UTSW	14	59423365	missense	possibly damaging	0.80
R6103:Setdb2	UTSW	14	59409532	splice site	probably null
R6106:Setdb2	UTSW	14	59423449	nonsense	probably null
R6388:Setdb2	UTSW	14	59424697	missense	probably benign
R6431:Setdb2	UTSW	14	59419056	missense	probably damaging	1.00
R6494:Setdb2	UTSW	14	59402414	missense	probably benign	0.12
R6971:Setdb2	UTSW	14	59415740	missense	probably damaging	1.00
R7442:Setdb2	UTSW	14	59419251	missense	probably damaging	0.99
R7444:Setdb2	UTSW	14	59423345	nonsense	probably null
R7759:Setdb2	UTSW	14	59419364	missense	probably damaging	1.00
R8021:Setdb2	UTSW	14	59423384	nonsense	probably null
R8039:Setdb2	UTSW	14	59402375	missense	probably damaging	1.00
R8261:Setdb2	UTSW	14	59413692	splice site	probably benign
R8393:Setdb2	UTSW	14	59412731	missense	probably benign	0.04
R8513:Setdb2	UTSW	14	59402390	missense	probably damaging	1.00
R8700:Setdb2	UTSW	14	59417439	missense	probably damaging	1.00
R8707:Setdb2	UTSW	14	59423458	nonsense	probably null
R8940:Setdb2	UTSW	14	59409507	missense	probably damaging	1.00
R9217:Setdb2	UTSW	14	59409432	missense	possibly damaging	0.61
R9314:Setdb2	UTSW	14	59412791	missense	probably benign	0.02
R9336:Setdb2	UTSW	14	59423367	missense	unknown
R9442:Setdb2	UTSW	14	59402400	missense	probably damaging	1.00
R9525:Setdb2	UTSW	14	59409392	missense	probably benign	0.00
R9743:Setdb2	UTSW	14	59413553	missense	probably benign	0.00
X0017:Setdb2	UTSW	14	59419468	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCGCTTGGTACCTTATGGC -3'
(R):5'- GCTAGTCAACCCAGGCAATC -3'

Sequencing Primer
(F):5'- CATTACGGATGGTTGTAAGCCACC -3'
(R):5'- AGGCAATCTAACCTTACACTACTTTC -3'

Posted On

2016-06-15