Mutagenetix > Incidental Mutations

Incidental Mutation 'R0445:Cnot1'

39321

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

038646-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0445 (G1)

Quality Score

195

Status

Validated

Chromosome

Chromosomal Location

95719451-95807464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 95760208 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 624 (C624R)

Ref Sequence

ENSEMBL: ENSMUSP00000096073 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006] [ENSMUST00000213046]

Predicted Effect

probably damaging
Transcript: ENSMUST00000068452
AA Change: C624R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: C624R

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083277

Predicted Effect

probably damaging
Transcript: ENSMUST00000098473
AA Change: C624R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: C624R

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196326

Predicted Effect

probably damaging
Transcript: ENSMUST00000211887
AA Change: C622R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211937

Predicted Effect

probably damaging
Transcript: ENSMUST00000211973
AA Change: C92R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212228

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212556

Predicted Effect

probably damaging
Transcript: ENSMUST00000213006
AA Change: C624R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000213046

Meta Mutation Damage Score

0.8570

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.3%

Validation Efficiency

100% (77/77)

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700067P10Rik	A	C	17: 48,090,022		probably null	Het
4932438A13Rik	T	C	3: 37,000,065	V3111A	probably damaging	Het
A2m	C	T	6: 121,657,955	T687I	probably damaging	Het
Acsbg1	A	G	9: 54,615,895	S483P	probably damaging	Het
Adam22	T	A	5: 8,180,591		probably benign	Het
Aggf1	A	G	13: 95,354,001	V595A	possibly damaging	Het
Aplf	A	T	6: 87,663,752	L71I	probably damaging	Het
Arid3c	G	T	4: 41,725,172	P292T	probably benign	Het
Brms1l	T	A	12: 55,861,406	Y213*	probably null	Het
C87436	T	A	6: 86,449,850	S332T	possibly damaging	Het
Cad	G	A	5: 31,072,709	A1454T	probably benign	Het
Cdkn3	T	C	14: 46,767,400		probably null	Het
Cntnap5c	A	T	17: 58,104,743	I541F	probably benign	Het
Cyhr1	T	C	15: 76,648,257	H217R	probably damaging	Het
Dennd1b	A	G	1: 139,167,765		probably benign	Het
Dscam	A	T	16: 96,772,503	I753N	probably damaging	Het
Eef2	C	CN	10: 81,178,770		probably null	Het
Epg5	T	A	18: 78,014,184	V1826D	possibly damaging	Het
Epha8	T	C	4: 136,932,400	Y755C	probably damaging	Het
Esco1	A	T	18: 10,574,989	N694K	probably damaging	Het
Fermt3	T	C	19: 7,003,299	H300R	probably benign	Het
Galnt5	C	A	2: 57,998,950	F187L	probably benign	Het
Gm17067	A	G	7: 42,708,622	I152T	probably benign	Het
Gnb3	T	C	6: 124,837,255	D154G	possibly damaging	Het
Gpr155	G	A	2: 73,370,144		probably benign	Het
Hdac3	A	G	18: 37,943,724	I240T	probably damaging	Het
Ifitm1	A	T	7: 140,968,441		probably null	Het
Kif1b	A	T	4: 149,188,009	L1455Q	probably benign	Het
Krt1	A	C	15: 101,847,621	L388R	probably damaging	Het
Lrp1	T	A	10: 127,590,636	K635*	probably null	Het
Map3k2	A	G	18: 32,217,210	Y371C	probably damaging	Het
Mcu	T	C	10: 59,456,645		probably benign	Het
Mkrn1	C	T	6: 39,404,854	V167I	probably benign	Het
Mrpl9	T	A	3: 94,444,891		probably benign	Het
Naip2	T	C	13: 100,161,887	Y547C	possibly damaging	Het
Nup88	G	A	11: 70,947,729	T487I	probably benign	Het
Oas3	G	A	5: 120,756,145	R39C	probably damaging	Het
Obscn	C	T	11: 58,999,335	R7457H	unknown	Het
Olfr1383	T	A	11: 49,523,957	V78E	probably damaging	Het
Olfr272	G	A	4: 52,910,849	T315M	probably benign	Het
Paf1	T	C	7: 28,395,688	S118P	probably damaging	Het
Parp4	T	A	14: 56,602,748		probably null	Het
Pcdh15	A	T	10: 74,342,549	Y157F	probably damaging	Het
Pex10	G	A	4: 155,069,074		probably null	Het
Phrf1	C	T	7: 141,247,331		probably benign	Het
Polr3a	G	T	14: 24,454,921	D1090E	probably benign	Het
Ppfia4	A	C	1: 134,327,289	L276R	probably benign	Het
Rdh16f1	T	C	10: 127,790,867	L263S	probably benign	Het
Ryr3	T	C	2: 112,866,054	D967G	probably benign	Het
Shc1	G	T	3: 89,426,537	A226S	probably damaging	Het
Slc4a1	A	G	11: 102,354,366	V585A	probably benign	Het
Stk38l	T	A	6: 146,775,686	S461T	probably benign	Het
Tbkbp1	A	T	11: 97,149,469	S40T	probably damaging	Het
Tet1	A	G	10: 62,879,941	M25T	probably benign	Het
Themis	A	G	10: 28,782,011	R192G	probably damaging	Het
Tmem144	T	C	3: 79,825,354	T206A	probably benign	Het
Tmem74b	G	A	2: 151,706,959	R202H	probably damaging	Het
Trpm1	T	C	7: 64,244,842		probably benign	Het
Vars	A	G	17: 35,011,809	H557R	probably benign	Het
Zbtb12	C	A	17: 34,896,301	A354E	possibly damaging	Het
Zfp143	A	T	7: 110,061,117		probably benign	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	95726079	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	95760537	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	95741009	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	95728718	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	95756133	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	95773485	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	95745017	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	95755078	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	95769615	intron	probably benign
IGL03174:Cnot1	APN	8	95761355	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	95735680	splice site	probably benign
IGL03371:Cnot1	APN	8	95774716	missense	possibly damaging	0.85
Affiliate	UTSW	8	95765125	missense	probably damaging	0.99
barge	UTSW	8	95734129	missense	probably benign	0.13
Byproduct	UTSW	8	95745647	frame shift	probably null
Chairman	UTSW	8	95765027	missense	possibly damaging	0.95
cohort	UTSW	8	95735749	missense	probably damaging	0.99
Director	UTSW	8	95765062	missense	probably benign	0.15
kowloon	UTSW	8	95788658	missense	probably damaging	1.00
tugboat	UTSW	8	95773618	missense	probably damaging	0.99
Xiao	UTSW	8	95730420	missense	probably damaging	1.00
BB001:Cnot1	UTSW	8	95745647	frame shift	probably null
BB003:Cnot1	UTSW	8	95745647	frame shift	probably null
BB011:Cnot1	UTSW	8	95745647	frame shift	probably null
BB013:Cnot1	UTSW	8	95745647	frame shift	probably null
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	95763144	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	95772000	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	95748855	missense	probably damaging	0.96
R1505:Cnot1	UTSW	8	95728667	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	95743213	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	95769832	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	95748276	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	95724577	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	95741944	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	95724593	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	95739841	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	95775358	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	95726153	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	95761426	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	95749062	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	95774652	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	95773618	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	95739848	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	95769779	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	95774682	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	95733231	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	95763067	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	95721626	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	95741008	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	95752768	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	95760187	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	95757355	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	95744296	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	95734147	nonsense	probably null
R5956:Cnot1	UTSW	8	95754978	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	95788665	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	95748894	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	95730420	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	95741921	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	95773267	intron	probably benign
R6882:Cnot1	UTSW	8	95720426	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	95724532	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	95734129	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	95788658	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	95733159	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	95727648	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	95751819	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	95770632	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	95760098	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	95765125	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	95765062	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	95751778	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	95745647	frame shift	probably null
R7914:Cnot1	UTSW	8	95745647	frame shift	probably null
R7924:Cnot1	UTSW	8	95745647	frame shift	probably null
R7926:Cnot1	UTSW	8	95745647	frame shift	probably null
R7981:Cnot1	UTSW	8	95763169	missense	probably damaging	1.00
R8004:Cnot1	UTSW	8	95752752	missense	probably benign	0.03
R8061:Cnot1	UTSW	8	95765027	missense	possibly damaging	0.95
R8185:Cnot1	UTSW	8	95761351	missense	probably damaging	1.00
R8269:Cnot1	UTSW	8	95751761	missense	probably damaging	1.00
R8306:Cnot1	UTSW	8	95747021	missense	probably benign	0.05
R8322:Cnot1	UTSW	8	95769844	missense	probably benign	0.00
R8427:Cnot1	UTSW	8	95734324	missense	probably benign	0.01
X0050:Cnot1	UTSW	8	95743098	splice site	probably null
Z1176:Cnot1	UTSW	8	95748277	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- TCCATCAGTGTCTACCTCCTGAGTG -3'
(R):5'- TCACGGCGGGAATACCTCAAAC -3'

Sequencing Primer
(F):5'- CTCCTGAGTGTCTCGGTAATAACG -3'
(R):5'- atgttagggaattaaactcatgacc -3'

Posted On

2013-05-23