Incidental Mutation 'R5041:Vmn2r43'
ID393210
Institutional Source Beutler Lab
Gene Symbol Vmn2r43
Ensembl Gene ENSMUSG00000053720
Gene Namevomeronasal 2, receptor 43
SynonymsEC2-V2R
MMRRC Submission 042631-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5041 (G1)
Quality Score172
Status Not validated
Chromosome7
Chromosomal Location8244348-8260599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8244807 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 786 (T786A)
Ref Sequence ENSEMBL: ENSMUSP00000069647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066317]
Predicted Effect probably damaging
Transcript: ENSMUST00000066317
AA Change: T786A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069647
Gene: ENSMUSG00000053720
AA Change: T786A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 453 5.1e-35 PFAM
Pfam:NCD3G 496 549 7.7e-21 PFAM
Pfam:7tm_3 582 817 3e-56 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A G 16: 56,730,348 F667S probably benign Het
Akna A G 4: 63,387,144 Y462H possibly damaging Het
Anxa11 G T 14: 25,874,764 E278* probably null Het
Ap3s2 T C 7: 79,920,519 Y20C probably benign Het
Atxn7 T C 14: 14,096,317 probably null Het
AW551984 T C 9: 39,600,598 Y39C probably damaging Het
Becn1 A T 11: 101,288,836 S442T probably benign Het
Bhlhe40 C T 6: 108,662,585 T108I probably damaging Het
Cnst A G 1: 179,605,028 D252G probably damaging Het
Cpxm1 A G 2: 130,394,070 S391P probably damaging Het
Ctnna2 T A 6: 76,915,763 N814Y probably damaging Het
Ddx3y T A Y: 1,266,611 Y282F probably benign Het
Ddx56 A G 11: 6,264,178 V357A probably damaging Het
Frmpd1 T G 4: 45,278,878 C534W probably damaging Het
Gimap8 A G 6: 48,659,163 N621D probably damaging Het
Gm13023 T C 4: 143,793,690 V4A probably benign Het
Herc1 T A 9: 66,429,045 I1624N possibly damaging Het
Htr7 A C 19: 36,057,067 W63G probably benign Het
Ly6g6c T A 17: 35,065,452 probably null Het
Macf1 T C 4: 123,397,046 probably null Het
Mfrp A G 9: 44,102,278 D62G probably damaging Het
Ncam1 T C 9: 49,566,785 Y173C probably damaging Het
Nwd1 T C 8: 72,705,055 V1185A possibly damaging Het
Olfr1218 A T 2: 89,054,921 C168* probably null Het
Olfr573-ps1 T C 7: 102,942,578 probably null Het
Papd5 CCCAACAACGCCAACAA CCCAACAA 8: 88,255,250 probably benign Het
Pcf11 G A 7: 92,658,405 P852S probably benign Het
Ralgapa2 T C 2: 146,485,151 I63V probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Rubcnl T C 14: 75,050,132 F619L probably damaging Het
Sec24d A T 3: 123,294,231 Q247L probably damaging Het
Spns3 G T 11: 72,536,547 Q306K possibly damaging Het
Sstr1 T C 12: 58,213,155 V188A possibly damaging Het
Supt5 A T 7: 28,315,380 L1024Q probably damaging Het
Thegl A G 5: 77,056,081 T319A probably benign Het
Unc13b T A 4: 43,237,836 H3452Q probably benign Het
Usp28 A G 9: 49,037,773 Q864R probably benign Het
Yy1 TCACCACCACCACCACCACCACCACCACC TCACCACCACCACCACCACCACCACCACCACC 12: 108,793,631 probably benign Het
Other mutations in Vmn2r43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01756:Vmn2r43 APN 7 8255584 missense probably benign 0.00
IGL01777:Vmn2r43 APN 7 8255273 missense probably damaging 1.00
IGL02096:Vmn2r43 APN 7 8257513 splice site probably benign
IGL02429:Vmn2r43 APN 7 8255552 missense probably benign 0.00
IGL03026:Vmn2r43 APN 7 8255097 missense probably benign 0.05
IGL03155:Vmn2r43 APN 7 8255069 missense possibly damaging 0.91
R1722:Vmn2r43 UTSW 7 8255068 missense probably damaging 0.99
R1813:Vmn2r43 UTSW 7 8255056 missense possibly damaging 0.81
R1896:Vmn2r43 UTSW 7 8255056 missense possibly damaging 0.81
R1975:Vmn2r43 UTSW 7 8255551 missense possibly damaging 0.91
R3951:Vmn2r43 UTSW 7 8255320 missense probably benign 0.00
R4658:Vmn2r43 UTSW 7 8255071 missense probably benign 0.01
R4879:Vmn2r43 UTSW 7 8255103 missense probably benign 0.01
R4896:Vmn2r43 UTSW 7 8244849 missense probably damaging 1.00
R5004:Vmn2r43 UTSW 7 8244849 missense probably damaging 1.00
R5577:Vmn2r43 UTSW 7 8244812 missense probably damaging 1.00
R6073:Vmn2r43 UTSW 7 8255185 missense probably benign 0.13
R6133:Vmn2r43 UTSW 7 8244971 missense probably damaging 1.00
R6867:Vmn2r43 UTSW 7 8255126 missense probably benign 0.00
R7214:Vmn2r43 UTSW 7 8253380 critical splice donor site probably null
R7339:Vmn2r43 UTSW 7 8255307 nonsense probably null
R7424:Vmn2r43 UTSW 7 8255329 missense probably damaging 0.99
R7534:Vmn2r43 UTSW 7 8255231 nonsense probably null
R7542:Vmn2r43 UTSW 7 8255489 missense probably benign 0.00
R7757:Vmn2r43 UTSW 7 8255254 missense possibly damaging 0.77
R8131:Vmn2r43 UTSW 7 8255327 missense probably benign 0.00
R8345:Vmn2r43 UTSW 7 8253602 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GAGCAACCAGTGAGAGTGATTC -3'
(R):5'- ACAAGGGCTCAGTTACTGC -3'

Sequencing Primer
(F):5'- CCAGTGAGAGTGATTCTAAAACTG -3'
(R):5'- AAGGGCTCAGTTACTGCATTCTACTG -3'
Posted On2016-06-15