Incidental Mutation 'R5041:Ap3s2'
ID393212
Institutional Source Beutler Lab
Gene Symbol Ap3s2
Ensembl Gene ENSMUSG00000063801
Gene Nameadaptor-related protein complex 3, sigma 2 subunit
Synonymssigma 3B, [s]3B
MMRRC Submission 042631-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5041 (G1)
Quality Score163
Status Validated
Chromosome7
Chromosomal Location79875325-79920649 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79920519 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 20 (Y20C)
Ref Sequence ENSEMBL: ENSMUSP00000075082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048731] [ENSMUST00000075657] [ENSMUST00000206725]
Predicted Effect probably benign
Transcript: ENSMUST00000048731
SMART Domains Protein: ENSMUSP00000049440
Gene: ENSMUSG00000039043

DomainStartEndE-ValueType
Pfam:UPF0552 1 224 4e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075657
AA Change: Y20C

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000075082
Gene: ENSMUSG00000063801
AA Change: Y20C

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 148 9.5e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206403
Predicted Effect unknown
Transcript: ENSMUST00000206725
AA Change: Y20C
Meta Mutation Damage Score 0.9540 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A G 16: 56,730,348 F667S probably benign Het
Akna A G 4: 63,387,144 Y462H possibly damaging Het
Anxa11 G T 14: 25,874,764 E278* probably null Het
Atxn7 T C 14: 14,096,317 probably null Het
AW551984 T C 9: 39,600,598 Y39C probably damaging Het
Becn1 A T 11: 101,288,836 S442T probably benign Het
Bhlhe40 C T 6: 108,662,585 T108I probably damaging Het
Cnst A G 1: 179,605,028 D252G probably damaging Het
Cpxm1 A G 2: 130,394,070 S391P probably damaging Het
Ctnna2 T A 6: 76,915,763 N814Y probably damaging Het
Ddx3y T A Y: 1,266,611 Y282F probably benign Het
Ddx56 A G 11: 6,264,178 V357A probably damaging Het
Frmpd1 T G 4: 45,278,878 C534W probably damaging Het
Gimap8 A G 6: 48,659,163 N621D probably damaging Het
Gm13023 T C 4: 143,793,690 V4A probably benign Het
Herc1 T A 9: 66,429,045 I1624N possibly damaging Het
Htr7 A C 19: 36,057,067 W63G probably benign Het
Ly6g6c T A 17: 35,065,452 probably null Het
Macf1 T C 4: 123,397,046 probably null Het
Mfrp A G 9: 44,102,278 D62G probably damaging Het
Ncam1 T C 9: 49,566,785 Y173C probably damaging Het
Nwd1 T C 8: 72,705,055 V1185A possibly damaging Het
Olfr1218 A T 2: 89,054,921 C168* probably null Het
Olfr573-ps1 T C 7: 102,942,578 probably null Het
Papd5 CCCAACAACGCCAACAA CCCAACAA 8: 88,255,250 probably benign Het
Pcf11 G A 7: 92,658,405 P852S probably benign Het
Ralgapa2 T C 2: 146,485,151 I63V probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Rubcnl T C 14: 75,050,132 F619L probably damaging Het
Sec24d A T 3: 123,294,231 Q247L probably damaging Het
Spns3 G T 11: 72,536,547 Q306K possibly damaging Het
Sstr1 T C 12: 58,213,155 V188A possibly damaging Het
Supt5 A T 7: 28,315,380 L1024Q probably damaging Het
Thegl A G 5: 77,056,081 T319A probably benign Het
Unc13b T A 4: 43,237,836 H3452Q probably benign Het
Usp28 A G 9: 49,037,773 Q864R probably benign Het
Vmn2r43 T C 7: 8,244,807 T786A probably damaging Het
Yy1 TCACCACCACCACCACCACCACCACCACC TCACCACCACCACCACCACCACCACCACCACC 12: 108,793,631 probably benign Het
Other mutations in Ap3s2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Ap3s2 APN 7 79916076 missense probably benign 0.35
R0138:Ap3s2 UTSW 7 79909869 missense probably benign 0.28
R0909:Ap3s2 UTSW 7 79880518 missense probably benign 0.01
R1711:Ap3s2 UTSW 7 79880490 missense probably damaging 0.98
R4909:Ap3s2 UTSW 7 79915241 missense possibly damaging 0.90
R5528:Ap3s2 UTSW 7 79880486 makesense probably null
R5630:Ap3s2 UTSW 7 79909899 missense probably damaging 1.00
R6725:Ap3s2 UTSW 7 79920642 unclassified probably benign
R7473:Ap3s2 UTSW 7 79916031 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTGTGTACTGAGTCTGTCC -3'
(R):5'- GGGTACCGAGACTAAGTTTCCG -3'

Sequencing Primer
(F):5'- GTGTACTGAGTCTGTCCCTAAGAC -3'
(R):5'- ACTAAGTTTCCGGGAGCAGC -3'
Posted On2016-06-15