Incidental Mutation 'R5041:AW551984'
ID393217
Institutional Source Beutler Lab
Gene Symbol AW551984
Ensembl Gene ENSMUSG00000038112
Gene Nameexpressed sequence AW551984
Synonyms
MMRRC Submission 042631-MU
Accession Numbers

Genbank: NM_178737; MGI: 2143322

Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5041 (G1)
Quality Score189
Status Validated
Chromosome9
Chromosomal Location39587396-39604403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39600598 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 39 (Y39C)
Ref Sequence ENSEMBL: ENSMUSP00000117262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042485] [ENSMUST00000119722] [ENSMUST00000130829] [ENSMUST00000141370]
Predicted Effect probably damaging
Transcript: ENSMUST00000042485
AA Change: Y39C

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042582
Gene: ENSMUSG00000038112
AA Change: Y39C

DomainStartEndE-ValueType
VIT 1 131 1.59e-47 SMART
VWA 279 460 1.04e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119722
AA Change: Y39C

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113212
Gene: ENSMUSG00000038112
AA Change: Y39C

DomainStartEndE-ValueType
VIT 1 131 1.59e-47 SMART
VWA 279 460 1.04e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130829
AA Change: Y39C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117262
Gene: ENSMUSG00000038112
AA Change: Y39C

DomainStartEndE-ValueType
Pfam:VIT_2 5 52 1.4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136814
Predicted Effect probably damaging
Transcript: ENSMUST00000141370
AA Change: Y39C

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117328
Gene: ENSMUSG00000038112
AA Change: Y39C

DomainStartEndE-ValueType
VIT 1 131 1.59e-47 SMART
Meta Mutation Damage Score 0.8477 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A G 16: 56,730,348 F667S probably benign Het
Akna A G 4: 63,387,144 Y462H possibly damaging Het
Anxa11 G T 14: 25,874,764 E278* probably null Het
Ap3s2 T C 7: 79,920,519 Y20C probably benign Het
Atxn7 T C 14: 14,096,317 probably null Het
Becn1 A T 11: 101,288,836 S442T probably benign Het
Bhlhe40 C T 6: 108,662,585 T108I probably damaging Het
Cnst A G 1: 179,605,028 D252G probably damaging Het
Cpxm1 A G 2: 130,394,070 S391P probably damaging Het
Ctnna2 T A 6: 76,915,763 N814Y probably damaging Het
Ddx3y T A Y: 1,266,611 Y282F probably benign Het
Ddx56 A G 11: 6,264,178 V357A probably damaging Het
Frmpd1 T G 4: 45,278,878 C534W probably damaging Het
Gimap8 A G 6: 48,659,163 N621D probably damaging Het
Gm13023 T C 4: 143,793,690 V4A probably benign Het
Herc1 T A 9: 66,429,045 I1624N possibly damaging Het
Htr7 A C 19: 36,057,067 W63G probably benign Het
Ly6g6c T A 17: 35,065,452 probably null Het
Macf1 T C 4: 123,397,046 probably null Het
Mfrp A G 9: 44,102,278 D62G probably damaging Het
Ncam1 T C 9: 49,566,785 Y173C probably damaging Het
Nwd1 T C 8: 72,705,055 V1185A possibly damaging Het
Olfr1218 A T 2: 89,054,921 C168* probably null Het
Olfr573-ps1 T C 7: 102,942,578 probably null Het
Papd5 CCCAACAACGCCAACAA CCCAACAA 8: 88,255,250 probably benign Het
Pcf11 G A 7: 92,658,405 P852S probably benign Het
Ralgapa2 T C 2: 146,485,151 I63V probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Rubcnl T C 14: 75,050,132 F619L probably damaging Het
Sec24d A T 3: 123,294,231 Q247L probably damaging Het
Spns3 G T 11: 72,536,547 Q306K possibly damaging Het
Sstr1 T C 12: 58,213,155 V188A possibly damaging Het
Supt5 A T 7: 28,315,380 L1024Q probably damaging Het
Thegl A G 5: 77,056,081 T319A probably benign Het
Unc13b T A 4: 43,237,836 H3452Q probably benign Het
Usp28 A G 9: 49,037,773 Q864R probably benign Het
Vmn2r43 T C 7: 8,244,807 T786A probably damaging Het
Yy1 TCACCACCACCACCACCACCACCACCACC TCACCACCACCACCACCACCACCACCACCACC 12: 108,793,631 probably benign Het
Other mutations in AW551984
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:AW551984 APN 9 39592849 missense probably benign 0.16
IGL00869:AW551984 APN 9 39593434 splice site probably benign
IGL01411:AW551984 APN 9 39593791 missense possibly damaging 0.69
IGL01744:AW551984 APN 9 39591272 missense probably benign 0.01
IGL02102:AW551984 APN 9 39589691 missense probably damaging 1.00
IGL02149:AW551984 APN 9 39592924 missense probably benign 0.06
IGL02151:AW551984 APN 9 39592945 missense probably benign 0.35
IGL02154:AW551984 APN 9 39589102 missense possibly damaging 0.93
IGL02158:AW551984 APN 9 39599325 missense probably null 0.99
IGL02574:AW551984 APN 9 39589086 missense possibly damaging 0.91
IGL02754:AW551984 APN 9 39596626 nonsense probably null
IGL02754:AW551984 APN 9 39593328 critical splice donor site probably null
IGL02838:AW551984 APN 9 39594643 missense probably damaging 1.00
IGL03240:AW551984 APN 9 39589122 missense probably benign 0.00
IGL03328:AW551984 APN 9 39597116 missense probably damaging 1.00
IGL03374:AW551984 APN 9 39599766 missense possibly damaging 0.52
PIT4260001:AW551984 UTSW 9 39592979 missense probably benign 0.08
R0141:AW551984 UTSW 9 39590644 missense probably damaging 1.00
R0269:AW551984 UTSW 9 39599950 missense probably damaging 1.00
R0365:AW551984 UTSW 9 39599321 missense probably benign 0.14
R0453:AW551984 UTSW 9 39600641 missense probably damaging 1.00
R0481:AW551984 UTSW 9 39600616 missense probably null 1.00
R1005:AW551984 UTSW 9 39593733 nonsense probably null
R1585:AW551984 UTSW 9 39599336 nonsense probably null
R2177:AW551984 UTSW 9 39599815 missense probably benign
R3117:AW551984 UTSW 9 39593360 missense probably benign 0.08
R3119:AW551984 UTSW 9 39593360 missense probably benign 0.08
R3162:AW551984 UTSW 9 39593029 missense probably damaging 1.00
R3162:AW551984 UTSW 9 39593029 missense probably damaging 1.00
R3836:AW551984 UTSW 9 39597908 unclassified probably benign
R3837:AW551984 UTSW 9 39597908 unclassified probably benign
R3839:AW551984 UTSW 9 39597908 unclassified probably benign
R4299:AW551984 UTSW 9 39592979 missense probably benign 0.08
R4422:AW551984 UTSW 9 39600077 missense probably null 0.00
R4713:AW551984 UTSW 9 39597153 missense probably benign 0.13
R4905:AW551984 UTSW 9 39597158 missense probably damaging 0.99
R4966:AW551984 UTSW 9 39597176 missense possibly damaging 0.92
R5022:AW551984 UTSW 9 39597965 missense probably benign 0.00
R5342:AW551984 UTSW 9 39594551 missense probably damaging 1.00
R5383:AW551984 UTSW 9 39590698 missense probably benign
R5443:AW551984 UTSW 9 39598029 missense possibly damaging 0.94
R5532:AW551984 UTSW 9 39597185 missense probably damaging 1.00
R5536:AW551984 UTSW 9 39592873 missense probably benign 0.04
R5586:AW551984 UTSW 9 39591263 missense probably benign 0.01
R5601:AW551984 UTSW 9 39591267 missense possibly damaging 0.87
R5618:AW551984 UTSW 9 39590704 missense probably damaging 1.00
R5701:AW551984 UTSW 9 39592822 missense probably benign 0.01
R6122:AW551984 UTSW 9 39593755 missense probably benign 0.00
R6142:AW551984 UTSW 9 39597114 missense probably benign 0.00
R6272:AW551984 UTSW 9 39598037 missense probably benign 0.06
R6429:AW551984 UTSW 9 39600614 missense probably damaging 1.00
R6659:AW551984 UTSW 9 39589099 missense probably benign 0.00
R6670:AW551984 UTSW 9 39592996 missense probably damaging 1.00
R6791:AW551984 UTSW 9 39600659 missense probably damaging 1.00
R7000:AW551984 UTSW 9 39600789 missense probably benign 0.11
R7077:AW551984 UTSW 9 39591427 missense probably benign
R7083:AW551984 UTSW 9 39597647 missense probably damaging 1.00
R7352:AW551984 UTSW 9 39592925 missense probably benign
R7475:AW551984 UTSW 9 39597940 missense probably damaging 1.00
R7534:AW551984 UTSW 9 39591481 missense probably benign 0.03
R7542:AW551984 UTSW 9 39594631 missense possibly damaging 0.95
R7708:AW551984 UTSW 9 39593755 missense probably benign 0.00
R7729:AW551984 UTSW 9 39599775 missense possibly damaging 0.89
R8122:AW551984 UTSW 9 39599369 missense probably damaging 1.00
Z1088:AW551984 UTSW 9 39590603 nonsense probably null
ZE80:AW551984 UTSW 9 39593667 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGTCACTGGAGCAGCTACAC -3'
(R):5'- AGCCAAGACTCTTAGTGCTG -3'

Sequencing Primer
(F):5'- CTGTGGATGACAAATTATCTGCACCC -3'
(R):5'- AGCCAAGACTCTTAGTGCTGGATTC -3'
Posted On2016-06-15