Incidental Mutation 'R5041:Usp28'
ID393219
Institutional Source Beutler Lab
Gene Symbol Usp28
Ensembl Gene ENSMUSG00000032267
Gene Nameubiquitin specific peptidase 28
Synonyms9830148O20Rik
MMRRC Submission 042631-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5041 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location48985375-49042517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49037773 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 864 (Q864R)
Ref Sequence ENSEMBL: ENSMUSP00000149207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047349] [ENSMUST00000213874] [ENSMUST00000215856]
Predicted Effect probably benign
Transcript: ENSMUST00000047349
AA Change: Q889R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047467
Gene: ENSMUSG00000032267
AA Change: Q889R

DomainStartEndE-ValueType
UIM 97 116 3.1e-3 SMART
Pfam:UCH 161 652 5.4e-52 PFAM
Pfam:UCH_1 162 626 2e-11 PFAM
low complexity region 695 705 N/A INTRINSIC
low complexity region 713 730 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213457
Predicted Effect probably benign
Transcript: ENSMUST00000213874
AA Change: Q864R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215118
Predicted Effect probably benign
Transcript: ENSMUST00000215856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216657
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a deubiquitinase involved in the DNA damage pathway and DNA damage-induced apoptosis. Overexpression of this gene is seen in several cancers. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit slightly decreased spleen weight and splenocyte number but show neither major signaling defects in DNA damage response nor developmental defects indicative of impaired double-strand break metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A G 16: 56,730,348 F667S probably benign Het
Akna A G 4: 63,387,144 Y462H possibly damaging Het
Anxa11 G T 14: 25,874,764 E278* probably null Het
Ap3s2 T C 7: 79,920,519 Y20C probably benign Het
Atxn7 T C 14: 14,096,317 probably null Het
AW551984 T C 9: 39,600,598 Y39C probably damaging Het
Becn1 A T 11: 101,288,836 S442T probably benign Het
Bhlhe40 C T 6: 108,662,585 T108I probably damaging Het
Cnst A G 1: 179,605,028 D252G probably damaging Het
Cpxm1 A G 2: 130,394,070 S391P probably damaging Het
Ctnna2 T A 6: 76,915,763 N814Y probably damaging Het
Ddx3y T A Y: 1,266,611 Y282F probably benign Het
Ddx56 A G 11: 6,264,178 V357A probably damaging Het
Frmpd1 T G 4: 45,278,878 C534W probably damaging Het
Gimap8 A G 6: 48,659,163 N621D probably damaging Het
Gm13023 T C 4: 143,793,690 V4A probably benign Het
Herc1 T A 9: 66,429,045 I1624N possibly damaging Het
Htr7 A C 19: 36,057,067 W63G probably benign Het
Ly6g6c T A 17: 35,065,452 probably null Het
Macf1 T C 4: 123,397,046 probably null Het
Mfrp A G 9: 44,102,278 D62G probably damaging Het
Ncam1 T C 9: 49,566,785 Y173C probably damaging Het
Nwd1 T C 8: 72,705,055 V1185A possibly damaging Het
Olfr1218 A T 2: 89,054,921 C168* probably null Het
Olfr573-ps1 T C 7: 102,942,578 probably null Het
Papd5 CCCAACAACGCCAACAA CCCAACAA 8: 88,255,250 probably benign Het
Pcf11 G A 7: 92,658,405 P852S probably benign Het
Ralgapa2 T C 2: 146,485,151 I63V probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Rubcnl T C 14: 75,050,132 F619L probably damaging Het
Sec24d A T 3: 123,294,231 Q247L probably damaging Het
Spns3 G T 11: 72,536,547 Q306K possibly damaging Het
Sstr1 T C 12: 58,213,155 V188A possibly damaging Het
Supt5 A T 7: 28,315,380 L1024Q probably damaging Het
Thegl A G 5: 77,056,081 T319A probably benign Het
Unc13b T A 4: 43,237,836 H3452Q probably benign Het
Vmn2r43 T C 7: 8,244,807 T786A probably damaging Het
Yy1 TCACCACCACCACCACCACCACCACCACC TCACCACCACCACCACCACCACCACCACCACC 12: 108,793,631 probably benign Het
Other mutations in Usp28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Usp28 APN 9 49028163 missense probably benign 0.01
IGL01105:Usp28 APN 9 49010250 missense probably damaging 1.00
IGL01124:Usp28 APN 9 49037213 missense probably damaging 1.00
IGL01304:Usp28 APN 9 49026819 missense probably damaging 0.99
IGL01527:Usp28 APN 9 49025873 missense probably benign 0.02
IGL01859:Usp28 APN 9 49024021 nonsense probably null
IGL01860:Usp28 APN 9 49032243 nonsense probably null
IGL02047:Usp28 APN 9 49035641 missense probably damaging 0.99
IGL02188:Usp28 APN 9 49024009 missense probably benign 0.00
IGL02267:Usp28 APN 9 49023965 missense probably damaging 1.00
IGL02472:Usp28 APN 9 49037769 missense possibly damaging 0.95
IGL02675:Usp28 APN 9 49039091 missense possibly damaging 0.81
IGL02982:Usp28 APN 9 49018439 missense probably benign 0.00
IGL03105:Usp28 APN 9 49039055 missense probably damaging 0.99
R0100:Usp28 UTSW 9 49035932 missense probably damaging 1.00
R0114:Usp28 UTSW 9 49039023 missense probably benign 0.00
R0196:Usp28 UTSW 9 49028278 missense probably damaging 0.96
R0206:Usp28 UTSW 9 49028269 missense probably damaging 1.00
R0349:Usp28 UTSW 9 49010281 nonsense probably null
R0379:Usp28 UTSW 9 49024067 missense possibly damaging 0.58
R0454:Usp28 UTSW 9 49039101 missense possibly damaging 0.94
R0479:Usp28 UTSW 9 49037213 missense probably damaging 1.00
R0540:Usp28 UTSW 9 49024060 missense probably benign
R0726:Usp28 UTSW 9 49003869 missense probably damaging 1.00
R0835:Usp28 UTSW 9 49001524 missense probably damaging 1.00
R0928:Usp28 UTSW 9 49030891 missense possibly damaging 0.60
R1271:Usp28 UTSW 9 49035961 critical splice donor site probably null
R1534:Usp28 UTSW 9 48985506 missense possibly damaging 0.92
R1539:Usp28 UTSW 9 49037796 missense probably benign 0.07
R1687:Usp28 UTSW 9 49024017 missense probably benign 0.00
R1867:Usp28 UTSW 9 49009194 missense probably benign 0.00
R1868:Usp28 UTSW 9 49016707 missense probably damaging 1.00
R1884:Usp28 UTSW 9 49035947 missense probably damaging 1.00
R2029:Usp28 UTSW 9 48985503 missense probably benign 0.22
R2046:Usp28 UTSW 9 49039075 missense probably damaging 1.00
R2379:Usp28 UTSW 9 49003095 missense probably null 0.94
R2404:Usp28 UTSW 9 49037258 critical splice donor site probably null
R3196:Usp28 UTSW 9 49025825 missense probably benign 0.03
R3831:Usp28 UTSW 9 49035638 missense probably benign 0.00
R3922:Usp28 UTSW 9 49030923 critical splice donor site probably null
R3924:Usp28 UTSW 9 49030923 critical splice donor site probably null
R3926:Usp28 UTSW 9 49030923 critical splice donor site probably null
R3943:Usp28 UTSW 9 49000366 missense probably benign 0.12
R4834:Usp28 UTSW 9 49001536 missense probably damaging 1.00
R5186:Usp28 UTSW 9 49010250 missense probably damaging 1.00
R5308:Usp28 UTSW 9 49037201 missense probably damaging 1.00
R5870:Usp28 UTSW 9 49025985 nonsense probably null
R6838:Usp28 UTSW 9 49000430 critical splice donor site probably null
R6959:Usp28 UTSW 9 49001542 missense probably damaging 1.00
R7058:Usp28 UTSW 9 49039156 missense probably damaging 1.00
R7348:Usp28 UTSW 9 49030877 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TCTTGCTCCGAGTGCAAAAC -3'
(R):5'- AGGCTGGCTCAACTTATCAAG -3'

Sequencing Primer
(F):5'- CAAAACAGCTGAGTCTGGCTGTG -3'
(R):5'- CTGGCTCAACTTATCAAGGGTTG -3'
Posted On2016-06-15