Incidental Mutation 'R5041:Ddx56'
ID393222
Institutional Source Beutler Lab
Gene Symbol Ddx56
Ensembl Gene ENSMUSG00000004393
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 56
SynonymsNOH61, D11Ertd619e, 2600001H07Rik
MMRRC Submission 042631-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R5041 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location6258919-6267772 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6264178 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 357 (V357A)
Ref Sequence ENSEMBL: ENSMUSP00000004507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004507] [ENSMUST00000151446]
Predicted Effect probably damaging
Transcript: ENSMUST00000004507
AA Change: V357A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004507
Gene: ENSMUSG00000004393
AA Change: V357A

DomainStartEndE-ValueType
DEXDc 26 234 4.13e-46 SMART
low complexity region 246 256 N/A INTRINSIC
HELICc 272 380 2.42e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139073
Predicted Effect probably benign
Transcript: ENSMUST00000151446
SMART Domains Protein: ENSMUSP00000122368
Gene: ENSMUSG00000004393

DomainStartEndE-ValueType
DEXDc 26 216 3.65e-38 SMART
low complexity region 228 236 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155874
Meta Mutation Damage Score 0.7330 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene shows ATPase activity in the presence of polynucleotides and associates with nucleoplasmic 65S preribosomal particles. This gene may be involved in ribosome synthesis, most likely during assembly of the large 60S ribosomal subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A G 16: 56,730,348 F667S probably benign Het
Akna A G 4: 63,387,144 Y462H possibly damaging Het
Anxa11 G T 14: 25,874,764 E278* probably null Het
Ap3s2 T C 7: 79,920,519 Y20C probably benign Het
Atxn7 T C 14: 14,096,317 probably null Het
AW551984 T C 9: 39,600,598 Y39C probably damaging Het
Becn1 A T 11: 101,288,836 S442T probably benign Het
Bhlhe40 C T 6: 108,662,585 T108I probably damaging Het
Cnst A G 1: 179,605,028 D252G probably damaging Het
Cpxm1 A G 2: 130,394,070 S391P probably damaging Het
Ctnna2 T A 6: 76,915,763 N814Y probably damaging Het
Ddx3y T A Y: 1,266,611 Y282F probably benign Het
Frmpd1 T G 4: 45,278,878 C534W probably damaging Het
Gimap8 A G 6: 48,659,163 N621D probably damaging Het
Gm13023 T C 4: 143,793,690 V4A probably benign Het
Herc1 T A 9: 66,429,045 I1624N possibly damaging Het
Htr7 A C 19: 36,057,067 W63G probably benign Het
Ly6g6c T A 17: 35,065,452 probably null Het
Macf1 T C 4: 123,397,046 probably null Het
Mfrp A G 9: 44,102,278 D62G probably damaging Het
Ncam1 T C 9: 49,566,785 Y173C probably damaging Het
Nwd1 T C 8: 72,705,055 V1185A possibly damaging Het
Olfr1218 A T 2: 89,054,921 C168* probably null Het
Olfr573-ps1 T C 7: 102,942,578 probably null Het
Papd5 CCCAACAACGCCAACAA CCCAACAA 8: 88,255,250 probably benign Het
Pcf11 G A 7: 92,658,405 P852S probably benign Het
Ralgapa2 T C 2: 146,485,151 I63V probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Rubcnl T C 14: 75,050,132 F619L probably damaging Het
Sec24d A T 3: 123,294,231 Q247L probably damaging Het
Spns3 G T 11: 72,536,547 Q306K possibly damaging Het
Sstr1 T C 12: 58,213,155 V188A possibly damaging Het
Supt5 A T 7: 28,315,380 L1024Q probably damaging Het
Thegl A G 5: 77,056,081 T319A probably benign Het
Unc13b T A 4: 43,237,836 H3452Q probably benign Het
Usp28 A G 9: 49,037,773 Q864R probably benign Het
Vmn2r43 T C 7: 8,244,807 T786A probably damaging Het
Yy1 TCACCACCACCACCACCACCACCACCACC TCACCACCACCACCACCACCACCACCACCACC 12: 108,793,631 probably benign Het
Other mutations in Ddx56
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Ddx56 APN 11 6264671 splice site probably null
IGL01764:Ddx56 APN 11 6265692 missense probably null 0.05
IGL02858:Ddx56 APN 11 6267667 missense probably damaging 0.99
IGL03075:Ddx56 APN 11 6261632 missense probably benign 0.00
R0972:Ddx56 UTSW 11 6267718 start codon destroyed probably null 0.99
R1652:Ddx56 UTSW 11 6267679 missense probably damaging 1.00
R1744:Ddx56 UTSW 11 6266396 missense probably damaging 1.00
R1793:Ddx56 UTSW 11 6266934 missense probably damaging 0.99
R1869:Ddx56 UTSW 11 6263993 missense possibly damaging 0.88
R1917:Ddx56 UTSW 11 6263937 critical splice donor site probably null
R2415:Ddx56 UTSW 11 6261727 unclassified probably benign
R3839:Ddx56 UTSW 11 6267712 missense probably benign 0.23
R4445:Ddx56 UTSW 11 6265770 splice site probably null
R6925:Ddx56 UTSW 11 6263980 missense probably damaging 1.00
R7412:Ddx56 UTSW 11 6261720 missense probably damaging 0.99
R8401:Ddx56 UTSW 11 6264199 missense probably damaging 1.00
Z1177:Ddx56 UTSW 11 6267445 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCAGAACTATGCCTGGGTTG -3'
(R):5'- TGCATGTCAGAACTCCGGTC -3'

Sequencing Primer
(F):5'- GTTGGCTCGAGCTGTCC -3'
(R):5'- CAGCTCCTGGAGTGATTCTAATG -3'
Posted On2016-06-15