Incidental Mutation 'R5041:Spns3'
ID393223
Institutional Source Beutler Lab
Gene Symbol Spns3
Ensembl Gene ENSMUSG00000020798
Gene Namespinster homolog 3
Synonyms9830002I17Rik
MMRRC Submission 042631-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5041 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location72494919-72550506 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 72536547 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 306 (Q306K)
Ref Sequence ENSEMBL: ENSMUSP00000090617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021154] [ENSMUST00000092940]
Predicted Effect probably benign
Transcript: ENSMUST00000021154
AA Change: Q284K

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000021154
Gene: ENSMUSG00000020798
AA Change: Q284K

DomainStartEndE-ValueType
low complexity region 9 25 N/A INTRINSIC
Pfam:MFS_1 47 402 2.4e-28 PFAM
Pfam:Sugar_tr 48 225 3.3e-9 PFAM
transmembrane domain 428 450 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000092940
AA Change: Q306K

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090617
Gene: ENSMUSG00000020798
AA Change: Q306K

DomainStartEndE-ValueType
low complexity region 9 25 N/A INTRINSIC
Pfam:Sugar_tr 44 248 1.5e-11 PFAM
Pfam:OATP 50 388 4.8e-9 PFAM
Pfam:MFS_1 55 425 4.2e-35 PFAM
transmembrane domain 450 472 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A G 16: 56,730,348 F667S probably benign Het
Akna A G 4: 63,387,144 Y462H possibly damaging Het
Anxa11 G T 14: 25,874,764 E278* probably null Het
Ap3s2 T C 7: 79,920,519 Y20C probably benign Het
Atxn7 T C 14: 14,096,317 probably null Het
AW551984 T C 9: 39,600,598 Y39C probably damaging Het
Becn1 A T 11: 101,288,836 S442T probably benign Het
Bhlhe40 C T 6: 108,662,585 T108I probably damaging Het
Cnst A G 1: 179,605,028 D252G probably damaging Het
Cpxm1 A G 2: 130,394,070 S391P probably damaging Het
Ctnna2 T A 6: 76,915,763 N814Y probably damaging Het
Ddx3y T A Y: 1,266,611 Y282F probably benign Het
Ddx56 A G 11: 6,264,178 V357A probably damaging Het
Frmpd1 T G 4: 45,278,878 C534W probably damaging Het
Gimap8 A G 6: 48,659,163 N621D probably damaging Het
Gm13023 T C 4: 143,793,690 V4A probably benign Het
Herc1 T A 9: 66,429,045 I1624N possibly damaging Het
Htr7 A C 19: 36,057,067 W63G probably benign Het
Ly6g6c T A 17: 35,065,452 probably null Het
Macf1 T C 4: 123,397,046 probably null Het
Mfrp A G 9: 44,102,278 D62G probably damaging Het
Ncam1 T C 9: 49,566,785 Y173C probably damaging Het
Nwd1 T C 8: 72,705,055 V1185A possibly damaging Het
Olfr1218 A T 2: 89,054,921 C168* probably null Het
Olfr573-ps1 T C 7: 102,942,578 probably null Het
Papd5 CCCAACAACGCCAACAA CCCAACAA 8: 88,255,250 probably benign Het
Pcf11 G A 7: 92,658,405 P852S probably benign Het
Ralgapa2 T C 2: 146,485,151 I63V probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Rubcnl T C 14: 75,050,132 F619L probably damaging Het
Sec24d A T 3: 123,294,231 Q247L probably damaging Het
Sstr1 T C 12: 58,213,155 V188A possibly damaging Het
Supt5 A T 7: 28,315,380 L1024Q probably damaging Het
Thegl A G 5: 77,056,081 T319A probably benign Het
Unc13b T A 4: 43,237,836 H3452Q probably benign Het
Usp28 A G 9: 49,037,773 Q864R probably benign Het
Vmn2r43 T C 7: 8,244,807 T786A probably damaging Het
Yy1 TCACCACCACCACCACCACCACCACCACC TCACCACCACCACCACCACCACCACCACCACC 12: 108,793,631 probably benign Het
Other mutations in Spns3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Spns3 APN 11 72499353 critical splice donor site probably null
IGL02731:Spns3 APN 11 72529577 missense probably damaging 1.00
IGL03400:Spns3 APN 11 72499675 missense possibly damaging 0.65
R0948:Spns3 UTSW 11 72545940 missense probably damaging 1.00
R1807:Spns3 UTSW 11 72538340 nonsense probably null
R2151:Spns3 UTSW 11 72545961 splice site probably benign
R2393:Spns3 UTSW 11 72550233 start gained probably benign
R3703:Spns3 UTSW 11 72499530 splice site probably benign
R4207:Spns3 UTSW 11 72538361 missense probably damaging 1.00
R4685:Spns3 UTSW 11 72537270 missense probably damaging 1.00
R4932:Spns3 UTSW 11 72499495 missense possibly damaging 0.47
R5009:Spns3 UTSW 11 72537201 missense probably damaging 1.00
R5997:Spns3 UTSW 11 72539078 missense probably damaging 1.00
R6179:Spns3 UTSW 11 72499523 missense probably damaging 1.00
R6277:Spns3 UTSW 11 72529640 missense possibly damaging 0.75
R7635:Spns3 UTSW 11 72539034 critical splice donor site probably null
R8312:Spns3 UTSW 11 72499708 missense probably damaging 1.00
X0017:Spns3 UTSW 11 72505065 missense possibly damaging 0.53
Z1176:Spns3 UTSW 11 72529582 nonsense probably null
Z1176:Spns3 UTSW 11 72536654 missense probably damaging 1.00
Z1176:Spns3 UTSW 11 72545890 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGCTCATTCAAAGCTGG -3'
(R):5'- ATCGTTAGGAAGGCTGCATCC -3'

Sequencing Primer
(F):5'- GGAAACTTAAGCCCGCTCTTG -3'
(R):5'- GTGGTCAGGCACTTGTAGC -3'
Posted On2016-06-15