Incidental Mutation 'R5041:Sstr1'
ID393225
Institutional Source Beutler Lab
Gene Symbol Sstr1
Ensembl Gene ENSMUSG00000035431
Gene Namesomatostatin receptor 1
SynonymsSmstr-1, sst1, Smstr1
MMRRC Submission 042631-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5041 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location58211772-58214444 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58213155 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 188 (V188A)
Ref Sequence ENSEMBL: ENSMUSP00000106299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044299] [ENSMUST00000110671]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044299
AA Change: V188A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000037045
Gene: ENSMUSG00000035431
AA Change: V188A

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 66 297 4.9e-8 PFAM
Pfam:7TM_GPCR_Srsx 69 338 2.7e-14 PFAM
Pfam:7tm_1 75 323 2.2e-65 PFAM
Pfam:7TM_GPCR_Srv 131 339 1.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110671
AA Change: V188A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106299
Gene: ENSMUSG00000035431
AA Change: V188A

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 66 299 4.8e-8 PFAM
Pfam:7TM_GPCR_Srsx 69 338 2.7e-14 PFAM
Pfam:7tm_1 75 323 4.1e-70 PFAM
Pfam:7TM_GPCR_Srv 131 339 1.8e-11 PFAM
Meta Mutation Damage Score 0.2413 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Somatostatins are peptide hormones that regulate diverse cellular functions such as neurotransmission, cell proliferation, and endocrine signaling as well as inhibiting the release of many hormones and other secretory proteins. Somatostatin has two active forms of 14 and 28 amino acids. The biological effects of somatostatins are mediated by a family of G-protein coupled somatostatin receptors that are expressed in a tissue-specific manner. The protein encoded by this gene is a member of the superfamily of somatostatin receptors having seven transmembrane segments. Somatostatin receptors form homodimers and heterodimers with other members of the superfamily as well as with other G-protein coupled receptors and receptor tyrosine kinases. This somatostatin receptor has greater affinity for somatostatin-14 than -28. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display abnormal eye electrophysiology. Mice homozygous for a second targeted mutation display hypoactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A G 16: 56,730,348 F667S probably benign Het
Akna A G 4: 63,387,144 Y462H possibly damaging Het
Anxa11 G T 14: 25,874,764 E278* probably null Het
Ap3s2 T C 7: 79,920,519 Y20C probably benign Het
Atxn7 T C 14: 14,096,317 probably null Het
AW551984 T C 9: 39,600,598 Y39C probably damaging Het
Becn1 A T 11: 101,288,836 S442T probably benign Het
Bhlhe40 C T 6: 108,662,585 T108I probably damaging Het
Cnst A G 1: 179,605,028 D252G probably damaging Het
Cpxm1 A G 2: 130,394,070 S391P probably damaging Het
Ctnna2 T A 6: 76,915,763 N814Y probably damaging Het
Ddx3y T A Y: 1,266,611 Y282F probably benign Het
Ddx56 A G 11: 6,264,178 V357A probably damaging Het
Frmpd1 T G 4: 45,278,878 C534W probably damaging Het
Gimap8 A G 6: 48,659,163 N621D probably damaging Het
Gm13023 T C 4: 143,793,690 V4A probably benign Het
Herc1 T A 9: 66,429,045 I1624N possibly damaging Het
Htr7 A C 19: 36,057,067 W63G probably benign Het
Ly6g6c T A 17: 35,065,452 probably null Het
Macf1 T C 4: 123,397,046 probably null Het
Mfrp A G 9: 44,102,278 D62G probably damaging Het
Ncam1 T C 9: 49,566,785 Y173C probably damaging Het
Nwd1 T C 8: 72,705,055 V1185A possibly damaging Het
Olfr1218 A T 2: 89,054,921 C168* probably null Het
Olfr573-ps1 T C 7: 102,942,578 probably null Het
Papd5 CCCAACAACGCCAACAA CCCAACAA 8: 88,255,250 probably benign Het
Pcf11 G A 7: 92,658,405 P852S probably benign Het
Ralgapa2 T C 2: 146,485,151 I63V probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Rubcnl T C 14: 75,050,132 F619L probably damaging Het
Sec24d A T 3: 123,294,231 Q247L probably damaging Het
Spns3 G T 11: 72,536,547 Q306K possibly damaging Het
Supt5 A T 7: 28,315,380 L1024Q probably damaging Het
Thegl A G 5: 77,056,081 T319A probably benign Het
Unc13b T A 4: 43,237,836 H3452Q probably benign Het
Usp28 A G 9: 49,037,773 Q864R probably benign Het
Vmn2r43 T C 7: 8,244,807 T786A probably damaging Het
Yy1 TCACCACCACCACCACCACCACCACCACC TCACCACCACCACCACCACCACCACCACCACC 12: 108,793,631 probably benign Het
Other mutations in Sstr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Sstr1 APN 12 58212750 missense probably benign
IGL01975:Sstr1 APN 12 58213626 missense probably benign 0.01
R0019:Sstr1 UTSW 12 58213149 missense probably damaging 1.00
R0019:Sstr1 UTSW 12 58213149 missense probably damaging 1.00
R0026:Sstr1 UTSW 12 58212858 missense probably damaging 1.00
R0083:Sstr1 UTSW 12 58213742 missense possibly damaging 0.85
R1218:Sstr1 UTSW 12 58213620 missense possibly damaging 0.68
R1254:Sstr1 UTSW 12 58213322 missense possibly damaging 0.93
R1815:Sstr1 UTSW 12 58213478 missense possibly damaging 0.81
R2318:Sstr1 UTSW 12 58212776 missense possibly damaging 0.77
R4588:Sstr1 UTSW 12 58213631 missense probably benign 0.00
R6556:Sstr1 UTSW 12 58213692 missense possibly damaging 0.94
R7332:Sstr1 UTSW 12 58213386 missense probably damaging 1.00
R7342:Sstr1 UTSW 12 58213670 missense possibly damaging 0.95
R7380:Sstr1 UTSW 12 58213280 missense probably benign 0.01
R7452:Sstr1 UTSW 12 58213356 missense probably damaging 1.00
R7873:Sstr1 UTSW 12 58213527 missense probably damaging 1.00
R7956:Sstr1 UTSW 12 58213527 missense probably damaging 1.00
Z1176:Sstr1 UTSW 12 58213526 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TGGTCACTTCCACGCTGTTG -3'
(R):5'- CTTGGCAATGATGAGCACATAAC -3'

Sequencing Primer
(F):5'- GCTACTTTGCCGCCTGGTG -3'
(R):5'- TGATGAGCACATAACACAGGC -3'
Posted On2016-06-15