Incidental Mutation 'R5041:Rubcnl'
ID393229
Institutional Source Beutler Lab
Gene Symbol Rubcnl
Ensembl Gene ENSMUSG00000034959
Gene NameRUN and cysteine rich domain containing beclin 1 interacting protein like
SynonymsLOC380917, 5031414D18Rik
MMRRC Submission 042631-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R5041 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location75016027-75052532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75050132 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 619 (F619L)
Ref Sequence ENSEMBL: ENSMUSP00000045566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036072]
Predicted Effect probably damaging
Transcript: ENSMUST00000036072
AA Change: F619L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045566
Gene: ENSMUSG00000034959
AA Change: F619L

DomainStartEndE-ValueType
DUF4206 463 664 1.01e-108 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228689
Meta Mutation Damage Score 0.2373 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A G 16: 56,730,348 F667S probably benign Het
Akna A G 4: 63,387,144 Y462H possibly damaging Het
Anxa11 G T 14: 25,874,764 E278* probably null Het
Ap3s2 T C 7: 79,920,519 Y20C probably benign Het
Atxn7 T C 14: 14,096,317 probably null Het
AW551984 T C 9: 39,600,598 Y39C probably damaging Het
Becn1 A T 11: 101,288,836 S442T probably benign Het
Bhlhe40 C T 6: 108,662,585 T108I probably damaging Het
Cnst A G 1: 179,605,028 D252G probably damaging Het
Cpxm1 A G 2: 130,394,070 S391P probably damaging Het
Ctnna2 T A 6: 76,915,763 N814Y probably damaging Het
Ddx3y T A Y: 1,266,611 Y282F probably benign Het
Ddx56 A G 11: 6,264,178 V357A probably damaging Het
Frmpd1 T G 4: 45,278,878 C534W probably damaging Het
Gimap8 A G 6: 48,659,163 N621D probably damaging Het
Gm13023 T C 4: 143,793,690 V4A probably benign Het
Herc1 T A 9: 66,429,045 I1624N possibly damaging Het
Htr7 A C 19: 36,057,067 W63G probably benign Het
Ly6g6c T A 17: 35,065,452 probably null Het
Macf1 T C 4: 123,397,046 probably null Het
Mfrp A G 9: 44,102,278 D62G probably damaging Het
Ncam1 T C 9: 49,566,785 Y173C probably damaging Het
Nwd1 T C 8: 72,705,055 V1185A possibly damaging Het
Olfr1218 A T 2: 89,054,921 C168* probably null Het
Olfr573-ps1 T C 7: 102,942,578 probably null Het
Papd5 CCCAACAACGCCAACAA CCCAACAA 8: 88,255,250 probably benign Het
Pcf11 G A 7: 92,658,405 P852S probably benign Het
Ralgapa2 T C 2: 146,485,151 I63V probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Sec24d A T 3: 123,294,231 Q247L probably damaging Het
Spns3 G T 11: 72,536,547 Q306K possibly damaging Het
Sstr1 T C 12: 58,213,155 V188A possibly damaging Het
Supt5 A T 7: 28,315,380 L1024Q probably damaging Het
Thegl A G 5: 77,056,081 T319A probably benign Het
Unc13b T A 4: 43,237,836 H3452Q probably benign Het
Usp28 A G 9: 49,037,773 Q864R probably benign Het
Vmn2r43 T C 7: 8,244,807 T786A probably damaging Het
Yy1 TCACCACCACCACCACCACCACCACCACC TCACCACCACCACCACCACCACCACCACCACC 12: 108,793,631 probably benign Het
Other mutations in Rubcnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02571:Rubcnl APN 14 75032136 missense possibly damaging 0.75
IGL02730:Rubcnl APN 14 75050148 missense probably damaging 1.00
R0019:Rubcnl UTSW 14 75048263 splice site probably benign
R0147:Rubcnl UTSW 14 75042458 missense probably damaging 1.00
R0148:Rubcnl UTSW 14 75042458 missense probably damaging 1.00
R0350:Rubcnl UTSW 14 75040891 missense probably damaging 0.99
R0487:Rubcnl UTSW 14 75036081 missense probably benign 0.18
R0558:Rubcnl UTSW 14 75047547 missense probably damaging 1.00
R1537:Rubcnl UTSW 14 75040827 missense possibly damaging 0.92
R1791:Rubcnl UTSW 14 75047549 missense probably damaging 1.00
R1871:Rubcnl UTSW 14 75042409 missense possibly damaging 0.58
R2227:Rubcnl UTSW 14 75042392 missense probably benign 0.00
R2263:Rubcnl UTSW 14 75040820 missense possibly damaging 0.93
R2910:Rubcnl UTSW 14 75040808 missense probably benign 0.06
R2911:Rubcnl UTSW 14 75040808 missense probably benign 0.06
R3826:Rubcnl UTSW 14 75032225 missense possibly damaging 0.72
R3870:Rubcnl UTSW 14 75040916 missense probably benign 0.00
R3871:Rubcnl UTSW 14 75040916 missense probably benign 0.00
R4007:Rubcnl UTSW 14 75049703 missense possibly damaging 0.93
R4161:Rubcnl UTSW 14 75044458 missense possibly damaging 0.82
R5004:Rubcnl UTSW 14 75032177 nonsense probably null
R5468:Rubcnl UTSW 14 75032031 missense possibly damaging 0.49
R5495:Rubcnl UTSW 14 75042337 missense possibly damaging 0.61
R5739:Rubcnl UTSW 14 75040941 splice site probably null
R5910:Rubcnl UTSW 14 75035472 missense probably benign 0.26
R5948:Rubcnl UTSW 14 75047616 missense probably damaging 1.00
R6038:Rubcnl UTSW 14 75031970 missense probably benign 0.00
R6038:Rubcnl UTSW 14 75031970 missense probably benign 0.00
R6197:Rubcnl UTSW 14 75031929 missense probably damaging 0.99
R6297:Rubcnl UTSW 14 75050144 missense probably benign 0.06
R6372:Rubcnl UTSW 14 75047569 missense probably damaging 0.99
R6376:Rubcnl UTSW 14 75032394 missense probably benign 0.01
R6377:Rubcnl UTSW 14 75050195 splice site probably null
R6724:Rubcnl UTSW 14 75052010 missense probably benign 0.00
R6884:Rubcnl UTSW 14 75035470 missense probably benign 0.23
R7183:Rubcnl UTSW 14 75049626 missense probably damaging 0.97
R7186:Rubcnl UTSW 14 75032013 missense possibly damaging 0.91
R7345:Rubcnl UTSW 14 75042353 missense probably benign
R7423:Rubcnl UTSW 14 75049643 missense probably benign 0.09
R7548:Rubcnl UTSW 14 75042352 missense probably benign
R7606:Rubcnl UTSW 14 75038874 missense probably benign 0.41
R7781:Rubcnl UTSW 14 75032090 missense probably damaging 1.00
RF011:Rubcnl UTSW 14 75044438 missense probably damaging 0.99
Z1176:Rubcnl UTSW 14 75036197 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GTTTGAAAGCCCATACCCTGTAAAG -3'
(R):5'- CTGAGGTATTCTTCAGTTTAAGCTAGC -3'

Sequencing Primer
(F):5'- GTAAAGCCCATTCTGTCCTGAAG -3'
(R):5'- AGTTTAAGCTAGCATTATGATGAAGC -3'
Posted On2016-06-15