Incidental Mutation 'R5041:Htr7'
ID393231
Institutional Source Beutler Lab
Gene Symbol Htr7
Ensembl Gene ENSMUSG00000024798
Gene Name5-hydroxytryptamine (serotonin) receptor 7
Synonyms5-HT7
MMRRC Submission 042631-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5041 (G1)
Quality Score175
Status Validated
Chromosome19
Chromosomal Location35958734-36057507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 36057067 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Glycine at position 63 (W63G)
Ref Sequence ENSEMBL: ENSMUSP00000131517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099505] [ENSMUST00000164639] [ENSMUST00000164781] [ENSMUST00000165215] [ENSMUST00000166074] [ENSMUST00000170360]
Predicted Effect probably benign
Transcript: ENSMUST00000099505
AA Change: W63G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000097105
Gene: ENSMUSG00000024798
AA Change: W63G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 95 402 2.3e-9 PFAM
Pfam:7tm_1 101 387 4.8e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164639
AA Change: W63G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000126847
Gene: ENSMUSG00000024798
AA Change: W63G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 95 402 1.3e-9 PFAM
Pfam:7tm_1 101 387 1.7e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164781
AA Change: W63G

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131912
Gene: ENSMUSG00000024798
AA Change: W63G

DomainStartEndE-ValueType
low complexity region 90 99 N/A INTRINSIC
Pfam:7tm_1 101 185 2.8e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165215
AA Change: W63G

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000128386
Gene: ENSMUSG00000024798
AA Change: W63G

DomainStartEndE-ValueType
low complexity region 90 99 N/A INTRINSIC
Pfam:7tm_1 101 183 7.1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166074
AA Change: W63G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126150
Gene: ENSMUSG00000024798
AA Change: W63G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 95 402 2.7e-9 PFAM
Pfam:7tm_1 101 387 5.6e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170360
AA Change: W63G

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131517
Gene: ENSMUSG00000024798
AA Change: W63G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 95 247 9.6e-9 PFAM
Pfam:7tm_1 101 252 1.4e-49 PFAM
Meta Mutation Damage Score 0.0782 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The neurotransmitter, serotonin, is thought to play a role in various cognitive and behavioral functions. The serotonin receptor encoded by this gene belongs to the superfamily of G protein-coupled receptors and the gene is a candidate locus for involvement in autistic disorder and other neuropsychiatric disorders. Three splice variants have been identified which encode proteins that differ in the length of their carboxy terminal ends. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display lower electrically- and chemically-induced seizure thresholds. Mice homozygous for a different knock-out allele show enhanced coordination and higher thermal nociceptive thresholds. Other nullizygous mutantsfail to exhibit agonist-induced hypothermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A G 16: 56,730,348 F667S probably benign Het
Akna A G 4: 63,387,144 Y462H possibly damaging Het
Anxa11 G T 14: 25,874,764 E278* probably null Het
Ap3s2 T C 7: 79,920,519 Y20C probably benign Het
Atxn7 T C 14: 14,096,317 probably null Het
AW551984 T C 9: 39,600,598 Y39C probably damaging Het
Becn1 A T 11: 101,288,836 S442T probably benign Het
Bhlhe40 C T 6: 108,662,585 T108I probably damaging Het
Cnst A G 1: 179,605,028 D252G probably damaging Het
Cpxm1 A G 2: 130,394,070 S391P probably damaging Het
Ctnna2 T A 6: 76,915,763 N814Y probably damaging Het
Ddx3y T A Y: 1,266,611 Y282F probably benign Het
Ddx56 A G 11: 6,264,178 V357A probably damaging Het
Frmpd1 T G 4: 45,278,878 C534W probably damaging Het
Gimap8 A G 6: 48,659,163 N621D probably damaging Het
Gm13023 T C 4: 143,793,690 V4A probably benign Het
Herc1 T A 9: 66,429,045 I1624N possibly damaging Het
Ly6g6c T A 17: 35,065,452 probably null Het
Macf1 T C 4: 123,397,046 probably null Het
Mfrp A G 9: 44,102,278 D62G probably damaging Het
Ncam1 T C 9: 49,566,785 Y173C probably damaging Het
Nwd1 T C 8: 72,705,055 V1185A possibly damaging Het
Olfr1218 A T 2: 89,054,921 C168* probably null Het
Olfr573-ps1 T C 7: 102,942,578 probably null Het
Papd5 CCCAACAACGCCAACAA CCCAACAA 8: 88,255,250 probably benign Het
Pcf11 G A 7: 92,658,405 P852S probably benign Het
Ralgapa2 T C 2: 146,485,151 I63V probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Rubcnl T C 14: 75,050,132 F619L probably damaging Het
Sec24d A T 3: 123,294,231 Q247L probably damaging Het
Spns3 G T 11: 72,536,547 Q306K possibly damaging Het
Sstr1 T C 12: 58,213,155 V188A possibly damaging Het
Supt5 A T 7: 28,315,380 L1024Q probably damaging Het
Thegl A G 5: 77,056,081 T319A probably benign Het
Unc13b T A 4: 43,237,836 H3452Q probably benign Het
Usp28 A G 9: 49,037,773 Q864R probably benign Het
Vmn2r43 T C 7: 8,244,807 T786A probably damaging Het
Yy1 TCACCACCACCACCACCACCACCACCACC TCACCACCACCACCACCACCACCACCACCACC 12: 108,793,631 probably benign Het
Other mutations in Htr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02683:Htr7 APN 19 35960362 missense probably benign 0.00
R0009:Htr7 UTSW 19 36041540 intron probably benign
R0318:Htr7 UTSW 19 35969486 missense probably damaging 1.00
R1695:Htr7 UTSW 19 35969736 missense probably benign 0.01
R2316:Htr7 UTSW 19 35969303 critical splice donor site probably null
R3973:Htr7 UTSW 19 36056760 missense probably damaging 1.00
R5203:Htr7 UTSW 19 35964392 missense probably benign 0.00
R5236:Htr7 UTSW 19 36056769 missense probably damaging 1.00
R5538:Htr7 UTSW 19 35969835 missense probably benign 0.34
R5682:Htr7 UTSW 19 35969871 missense probably damaging 1.00
R5683:Htr7 UTSW 19 35969871 missense probably damaging 1.00
R5684:Htr7 UTSW 19 35969871 missense probably damaging 1.00
R5686:Htr7 UTSW 19 35969871 missense probably damaging 1.00
R5694:Htr7 UTSW 19 36057121 missense probably benign 0.00
R6273:Htr7 UTSW 19 36041569 intron probably benign
R6502:Htr7 UTSW 19 35969610 missense probably damaging 1.00
R6558:Htr7 UTSW 19 36057240 missense probably damaging 1.00
R6884:Htr7 UTSW 19 35964379 critical splice donor site probably null
R7074:Htr7 UTSW 19 36056883 missense probably damaging 0.99
R7592:Htr7 UTSW 19 36056892 missense probably damaging 1.00
X0064:Htr7 UTSW 19 36056755 missense possibly damaging 0.70
Z1176:Htr7 UTSW 19 35969423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACGAAAGGCATGACCGC -3'
(R):5'- ATGGACGTTAACAGCAGCGG -3'

Sequencing Primer
(F):5'- CCAGGGACACAATCAGGTAGTTG -3'
(R):5'- GCCGCCCCGACCTCTAC -3'
Posted On2016-06-15