Incidental Mutation 'R5041:Ddx3y'
ID393232
Institutional Source Beutler Lab
Gene Symbol Ddx3y
Ensembl Gene ENSMUSG00000069045
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked
SynonymsDby, D1Pas1-rs1, 8030469F12Rik
MMRRC Submission 042631-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.029) question?
Stock #R5041 (G1)
Quality Score222
Status Validated
ChromosomeY
Chromosomal Location1260771-1286629 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 1266611 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 282 (Y282F)
Ref Sequence ENSEMBL: ENSMUSP00000088729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091190] [ENSMUST00000188484]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084813
Predicted Effect probably benign
Transcript: ENSMUST00000091190
AA Change: Y282F

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000088729
Gene: ENSMUSG00000069045
AA Change: Y282F

DomainStartEndE-ValueType
low complexity region 124 136 N/A INTRINSIC
low complexity region 184 195 N/A INTRINSIC
DEXDc 198 417 3.39e-65 SMART
HELICc 454 535 2.61e-34 SMART
low complexity region 580 596 N/A INTRINSIC
low complexity region 603 650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188182
Predicted Effect probably benign
Transcript: ENSMUST00000188484
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the DEAD-box RNA helicase family, characterized by nine conserved motifs, included the conserved Asp-Glu-Ala-Asp (DEAD) motif. These motifs are thought to be involved in ATP binding, hydrolysis, RNA binding, and in the formation of intramolecular interactions. This protein shares high similarity to DDX3X, on the X chromosome, but a deletion of this gene is not complemented by DDX3X. Mutations in this gene result in male infertility, a reduction in germ cell numbers, and can result in Sertoli-cell only sydrome. Pseudogenes sharing similarity to both this gene and the DDX3X paralog are found on chromosome 4 and the X chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A G 16: 56,730,348 F667S probably benign Het
Akna A G 4: 63,387,144 Y462H possibly damaging Het
Anxa11 G T 14: 25,874,764 E278* probably null Het
Ap3s2 T C 7: 79,920,519 Y20C probably benign Het
Atxn7 T C 14: 14,096,317 probably null Het
AW551984 T C 9: 39,600,598 Y39C probably damaging Het
Becn1 A T 11: 101,288,836 S442T probably benign Het
Bhlhe40 C T 6: 108,662,585 T108I probably damaging Het
Cnst A G 1: 179,605,028 D252G probably damaging Het
Cpxm1 A G 2: 130,394,070 S391P probably damaging Het
Ctnna2 T A 6: 76,915,763 N814Y probably damaging Het
Ddx56 A G 11: 6,264,178 V357A probably damaging Het
Frmpd1 T G 4: 45,278,878 C534W probably damaging Het
Gimap8 A G 6: 48,659,163 N621D probably damaging Het
Gm13023 T C 4: 143,793,690 V4A probably benign Het
Herc1 T A 9: 66,429,045 I1624N possibly damaging Het
Htr7 A C 19: 36,057,067 W63G probably benign Het
Ly6g6c T A 17: 35,065,452 probably null Het
Macf1 T C 4: 123,397,046 probably null Het
Mfrp A G 9: 44,102,278 D62G probably damaging Het
Ncam1 T C 9: 49,566,785 Y173C probably damaging Het
Nwd1 T C 8: 72,705,055 V1185A possibly damaging Het
Olfr1218 A T 2: 89,054,921 C168* probably null Het
Olfr573-ps1 T C 7: 102,942,578 probably null Het
Papd5 CCCAACAACGCCAACAA CCCAACAA 8: 88,255,250 probably benign Het
Pcf11 G A 7: 92,658,405 P852S probably benign Het
Ralgapa2 T C 2: 146,485,151 I63V probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Rubcnl T C 14: 75,050,132 F619L probably damaging Het
Sec24d A T 3: 123,294,231 Q247L probably damaging Het
Spns3 G T 11: 72,536,547 Q306K possibly damaging Het
Sstr1 T C 12: 58,213,155 V188A possibly damaging Het
Supt5 A T 7: 28,315,380 L1024Q probably damaging Het
Thegl A G 5: 77,056,081 T319A probably benign Het
Unc13b T A 4: 43,237,836 H3452Q probably benign Het
Usp28 A G 9: 49,037,773 Q864R probably benign Het
Vmn2r43 T C 7: 8,244,807 T786A probably damaging Het
Yy1 TCACCACCACCACCACCACCACCACCACC TCACCACCACCACCACCACCACCACCACCACC 12: 108,793,631 probably benign Het
Other mutations in Ddx3y
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03134:Ddx3y UTSW Y 1278949 missense possibly damaging 0.93
R0326:Ddx3y UTSW Y 1263321 nonsense probably null
R1755:Ddx3y UTSW Y 1279543 missense probably benign 0.00
R2029:Ddx3y UTSW Y 1266389 missense probably benign 0.05
R2076:Ddx3y UTSW Y 1266593 critical splice donor site probably null
R3610:Ddx3y UTSW Y 1263928 missense probably null 1.00
R3973:Ddx3y UTSW Y 1267170 missense probably damaging 1.00
R5396:Ddx3y UTSW Y 1265965 missense probably damaging 1.00
R6266:Ddx3y UTSW Y 1266635 missense probably damaging 1.00
R6473:Ddx3y UTSW Y 1265971 missense possibly damaging 0.93
R7048:Ddx3y UTSW Y 1279491 missense probably benign 0.00
R7900:Ddx3y UTSW Y 1266594 critical splice donor site probably null
R8090:Ddx3y UTSW Y 1264897 missense probably benign 0.00
R8203:Ddx3y UTSW Y 1269827 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCACGTTCTAAGTCCCGAATC -3'
(R):5'- AAATTACATGTGGCACTGTGG -3'

Sequencing Primer
(F):5'- GTTCTAAGTCCCGAATCTGCTGAAC -3'
(R):5'- TCACAAATGTCTGTAACTCCAGGG -3'
Posted On2016-06-15