Incidental Mutation 'R5042:Snph'
ID393236
Institutional Source Beutler Lab
Gene Symbol Snph
Ensembl Gene ENSMUSG00000027457
Gene Namesyntaphilin
Synonyms
MMRRC Submission 042632-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5042 (G1)
Quality Score132
Status Validated
Chromosome2
Chromosomal Location151590549-151632593 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 151601057 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 35 (I35F)
Ref Sequence ENSEMBL: ENSMUSP00000138114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028951] [ENSMUST00000094456] [ENSMUST00000109875] [ENSMUST00000109877] [ENSMUST00000137936] [ENSMUST00000146172] [ENSMUST00000148755]
Predicted Effect probably benign
Transcript: ENSMUST00000028951
SMART Domains Protein: ENSMUSP00000028951
Gene: ENSMUSG00000027457

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:Syntaphilin 50 367 9.3e-141 PFAM
low complexity region 436 449 N/A INTRINSIC
low complexity region 466 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094456
SMART Domains Protein: ENSMUSP00000092026
Gene: ENSMUSG00000027457

DomainStartEndE-ValueType
Pfam:Syntaphilin 17 334 7.7e-141 PFAM
low complexity region 403 416 N/A INTRINSIC
low complexity region 433 443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109875
SMART Domains Protein: ENSMUSP00000105501
Gene: ENSMUSG00000027457

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:Syntaphilin 51 366 1.7e-145 PFAM
low complexity region 436 449 N/A INTRINSIC
low complexity region 466 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109877
SMART Domains Protein: ENSMUSP00000105503
Gene: ENSMUSG00000027457

DomainStartEndE-ValueType
Pfam:Syntaphilin 2 298 3.2e-125 PFAM
low complexity region 367 380 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137936
SMART Domains Protein: ENSMUSP00000123255
Gene: ENSMUSG00000027457

DomainStartEndE-ValueType
Pfam:Syntaphilin 17 87 4.6e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145434
Predicted Effect possibly damaging
Transcript: ENSMUST00000146172
AA Change: I35F

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138114
Gene: ENSMUSG00000027457
AA Change: I35F

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148755
Meta Mutation Damage Score 0.0619 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin-1, synaptobrevin/VAMP, and SNAP25 interact to form the SNARE complex, which is required for synaptic vesicle docking and fusion. The protein encoded by this gene is membrane-associated and inhibits SNARE complex formation by binding free syntaxin-1. Expression of this gene appears to be brain-specific. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice with disruptions in this gene are viable, fertile, and morphologically normal. However, they do display subtile deficiencies in coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,502 noncoding transcript Het
4933413J09Rik C A 14: 26,376,281 noncoding transcript Het
Aldh1a2 A G 9: 71,285,004 I413V possibly damaging Het
Alpk2 C T 18: 65,350,508 W143* probably null Het
Anpep G T 7: 79,839,469 N318K probably benign Het
Art5 A T 7: 102,099,465 L10H probably damaging Het
Atg2b T G 12: 105,621,262 H1981P probably benign Het
B3gnt3 T C 8: 71,692,888 T279A probably damaging Het
Bmp10 G T 6: 87,434,057 E277D probably damaging Het
Ccdc180 A G 4: 45,916,255 T191A probably damaging Het
Dars2 T A 1: 161,045,094 probably benign Het
F5 T A 1: 164,219,451 I2160N probably damaging Het
Fndc7 A T 3: 108,862,786 V608D probably damaging Het
Gad1-ps A T 10: 99,445,654 noncoding transcript Het
Gbp2b A G 3: 142,611,463 K527E probably benign Het
Gm10719 T A 9: 3,018,970 F72I probably damaging Het
Hes3 T A 4: 152,287,043 S150C possibly damaging Het
Hp1bp3 T A 4: 138,222,108 M1K probably null Het
Il17rd T A 14: 27,096,041 V229E probably damaging Het
Iqch A G 9: 63,496,234 M634T possibly damaging Het
Magel2 C T 7: 62,379,606 R753W unknown Het
Med26 A G 8: 72,497,075 V60A probably damaging Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Nat1 T G 8: 67,491,576 D201E probably benign Het
Nav3 G T 10: 109,769,268 S981R probably benign Het
Nbn C A 4: 15,981,446 L513M probably benign Het
Nfatc3 T C 8: 106,108,125 V701A probably benign Het
Nlrp9a A G 7: 26,571,278 D911G probably damaging Het
Npr2 A T 4: 43,647,002 I712F probably damaging Het
Olfr514 A G 7: 108,825,471 I176T possibly damaging Het
Oplah G A 15: 76,305,709 R235* probably null Het
Pcdha11 T A 18: 37,011,596 Y247N probably damaging Het
Pcdhga9 A G 18: 37,737,577 Y153C probably damaging Het
Pkd1 A T 17: 24,569,887 D873V probably benign Het
Pnpla1 A G 17: 28,881,047 N296S probably benign Het
Ppfia3 A G 7: 45,342,341 V839A probably damaging Het
Ppm1j A T 3: 104,782,720 Q148L probably null Het
Prune2 T A 19: 17,119,797 N888K possibly damaging Het
Sh3bgr A G 16: 96,205,866 D12G probably benign Het
Spag17 A T 3: 100,072,149 D1442V probably damaging Het
Spidr T C 16: 16,118,903 T113A probably benign Het
St13 A T 15: 81,365,492 N349K probably damaging Het
Ttll6 C T 11: 96,154,604 S549F possibly damaging Het
Uap1l1 A T 2: 25,362,085 S473T possibly damaging Het
Vmn1r54 T C 6: 90,269,440 V112A possibly damaging Het
Vmn2r57 G A 7: 41,428,662 S124L probably benign Het
Wasf2 A T 4: 133,176,564 R28W probably benign Het
Wwp2 T A 8: 107,548,485 N417K possibly damaging Het
Zc3h13 A T 14: 75,339,396 D1648V probably damaging Het
Other mutations in Snph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Snph APN 2 151594173 nonsense probably null
IGL02017:Snph APN 2 151600982 missense probably damaging 1.00
IGL02029:Snph APN 2 151593607 missense probably damaging 1.00
IGL02186:Snph APN 2 151594343 missense possibly damaging 0.67
R0621:Snph UTSW 2 151593722 missense probably damaging 1.00
R1311:Snph UTSW 2 151597202 missense probably damaging 1.00
R1660:Snph UTSW 2 151594478 nonsense probably null
R3753:Snph UTSW 2 151593454 missense probably benign 0.00
R3923:Snph UTSW 2 151593511 missense probably damaging 1.00
R4081:Snph UTSW 2 151593802 missense probably damaging 1.00
R4082:Snph UTSW 2 151593802 missense probably damaging 1.00
R4461:Snph UTSW 2 151593847 missense probably benign 0.00
R4462:Snph UTSW 2 151594115 missense probably damaging 1.00
R4463:Snph UTSW 2 151594115 missense probably damaging 1.00
R4619:Snph UTSW 2 151594514 nonsense probably null
R5180:Snph UTSW 2 151600387 missense probably benign 0.05
R5184:Snph UTSW 2 151594544 missense probably damaging 1.00
R5925:Snph UTSW 2 151594231 missense probably damaging 1.00
R7169:Snph UTSW 2 151594387 missense probably damaging 1.00
R7243:Snph UTSW 2 151594253 missense probably damaging 0.99
R7417:Snph UTSW 2 151600343 missense probably damaging 1.00
R7607:Snph UTSW 2 151594586 missense probably damaging 1.00
R8517:Snph UTSW 2 151593721 missense probably damaging 0.99
X0024:Snph UTSW 2 151594204 missense probably benign 0.37
Z1177:Snph UTSW 2 151593634 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- AAGGCACGCTACAAGTCTGC -3'
(R):5'- AAACTGGGGTTAGCAGCCTG -3'

Sequencing Primer
(F):5'- AGTCTGCTGCACACACTG -3'
(R):5'- CCACTGAATTCACTGGTGGAG -3'
Posted On2016-06-15