Incidental Mutation 'R5042:Fndc7'
ID393239
Institutional Source Beutler Lab
Gene Symbol Fndc7
Ensembl Gene ENSMUSG00000045326
Gene Namefibronectin type III domain containing 7
Synonyms
MMRRC Submission 042632-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5042 (G1)
Quality Score220
Status Validated
Chromosome3
Chromosomal Location108853678-108890008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108862786 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 608 (V608D)
Ref Sequence ENSEMBL: ENSMUSP00000051172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053065] [ENSMUST00000102620] [ENSMUST00000180063]
Predicted Effect probably damaging
Transcript: ENSMUST00000053065
AA Change: V608D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051172
Gene: ENSMUSG00000045326
AA Change: V608D

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
FN3 29 102 2.62e-5 SMART
FN3 113 189 1.31e-5 SMART
Blast:FN3 201 274 9e-44 BLAST
FN3 283 360 1.07e-1 SMART
FN3 457 530 5.1e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102620
AA Change: V694D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099680
Gene: ENSMUSG00000045326
AA Change: V694D

DomainStartEndE-ValueType
FN3 29 102 2.62e-5 SMART
FN3 113 189 1.31e-5 SMART
FN3 201 275 2.44e-5 SMART
Blast:FN3 287 360 1e-43 BLAST
FN3 369 446 1.07e-1 SMART
FN3 543 616 5.1e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151713
Predicted Effect probably damaging
Transcript: ENSMUST00000180063
AA Change: V694D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136215
Gene: ENSMUSG00000045326
AA Change: V694D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FN3 29 102 2.62e-5 SMART
FN3 113 189 1.31e-5 SMART
FN3 201 275 2.44e-5 SMART
Blast:FN3 287 360 2e-43 BLAST
FN3 369 446 1.07e-1 SMART
FN3 543 616 5.1e1 SMART
Meta Mutation Damage Score 0.3246 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,502 noncoding transcript Het
4933413J09Rik C A 14: 26,376,281 noncoding transcript Het
Aldh1a2 A G 9: 71,285,004 I413V possibly damaging Het
Alpk2 C T 18: 65,350,508 W143* probably null Het
Anpep G T 7: 79,839,469 N318K probably benign Het
Art5 A T 7: 102,099,465 L10H probably damaging Het
Atg2b T G 12: 105,621,262 H1981P probably benign Het
B3gnt3 T C 8: 71,692,888 T279A probably damaging Het
Bmp10 G T 6: 87,434,057 E277D probably damaging Het
Ccdc180 A G 4: 45,916,255 T191A probably damaging Het
Dars2 T A 1: 161,045,094 probably benign Het
F5 T A 1: 164,219,451 I2160N probably damaging Het
Gad1-ps A T 10: 99,445,654 noncoding transcript Het
Gbp2b A G 3: 142,611,463 K527E probably benign Het
Gm10719 T A 9: 3,018,970 F72I probably damaging Het
Hes3 T A 4: 152,287,043 S150C possibly damaging Het
Hp1bp3 T A 4: 138,222,108 M1K probably null Het
Il17rd T A 14: 27,096,041 V229E probably damaging Het
Iqch A G 9: 63,496,234 M634T possibly damaging Het
Magel2 C T 7: 62,379,606 R753W unknown Het
Med26 A G 8: 72,497,075 V60A probably damaging Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Nat1 T G 8: 67,491,576 D201E probably benign Het
Nav3 G T 10: 109,769,268 S981R probably benign Het
Nbn C A 4: 15,981,446 L513M probably benign Het
Nfatc3 T C 8: 106,108,125 V701A probably benign Het
Nlrp9a A G 7: 26,571,278 D911G probably damaging Het
Npr2 A T 4: 43,647,002 I712F probably damaging Het
Olfr514 A G 7: 108,825,471 I176T possibly damaging Het
Oplah G A 15: 76,305,709 R235* probably null Het
Pcdha11 T A 18: 37,011,596 Y247N probably damaging Het
Pcdhga9 A G 18: 37,737,577 Y153C probably damaging Het
Pkd1 A T 17: 24,569,887 D873V probably benign Het
Pnpla1 A G 17: 28,881,047 N296S probably benign Het
Ppfia3 A G 7: 45,342,341 V839A probably damaging Het
Ppm1j A T 3: 104,782,720 Q148L probably null Het
Prune2 T A 19: 17,119,797 N888K possibly damaging Het
Sh3bgr A G 16: 96,205,866 D12G probably benign Het
Snph T A 2: 151,601,057 I35F possibly damaging Het
Spag17 A T 3: 100,072,149 D1442V probably damaging Het
Spidr T C 16: 16,118,903 T113A probably benign Het
St13 A T 15: 81,365,492 N349K probably damaging Het
Ttll6 C T 11: 96,154,604 S549F possibly damaging Het
Uap1l1 A T 2: 25,362,085 S473T possibly damaging Het
Vmn1r54 T C 6: 90,269,440 V112A possibly damaging Het
Vmn2r57 G A 7: 41,428,662 S124L probably benign Het
Wasf2 A T 4: 133,176,564 R28W probably benign Het
Wwp2 T A 8: 107,548,485 N417K possibly damaging Het
Zc3h13 A T 14: 75,339,396 D1648V probably damaging Het
Other mutations in Fndc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02077:Fndc7 APN 3 108883468 missense probably benign 0.17
IGL02823:Fndc7 APN 3 108869171 missense probably damaging 1.00
IGL02896:Fndc7 APN 3 108862931 missense probably benign 0.04
IGL03196:Fndc7 APN 3 108883444 missense probably damaging 1.00
IGL03343:Fndc7 APN 3 108867308 missense probably damaging 1.00
IGL03377:Fndc7 APN 3 108876532 missense probably benign 0.12
R0240:Fndc7 UTSW 3 108858919 splice site probably benign
R0324:Fndc7 UTSW 3 108876699 splice site probably null
R0457:Fndc7 UTSW 3 108876545 missense probably benign 0.02
R0630:Fndc7 UTSW 3 108876615 missense probably damaging 1.00
R0891:Fndc7 UTSW 3 108870588 missense possibly damaging 0.54
R1752:Fndc7 UTSW 3 108869330 missense probably benign 0.14
R1772:Fndc7 UTSW 3 108870534 missense probably damaging 1.00
R1923:Fndc7 UTSW 3 108876687 missense probably benign 0.00
R1957:Fndc7 UTSW 3 108883509 missense probably damaging 0.98
R3801:Fndc7 UTSW 3 108869148 missense possibly damaging 0.95
R4592:Fndc7 UTSW 3 108858902 missense probably damaging 1.00
R4650:Fndc7 UTSW 3 108862819 missense probably benign 0.15
R4652:Fndc7 UTSW 3 108862819 missense probably benign 0.15
R4791:Fndc7 UTSW 3 108876659 missense probably benign 0.00
R4933:Fndc7 UTSW 3 108876670 missense probably benign 0.01
R5004:Fndc7 UTSW 3 108883473 missense probably damaging 1.00
R5054:Fndc7 UTSW 3 108881347 missense probably damaging 0.97
R5175:Fndc7 UTSW 3 108869166 missense probably benign 0.04
R5325:Fndc7 UTSW 3 108883449 missense probably damaging 1.00
R5571:Fndc7 UTSW 3 108856408 missense possibly damaging 0.68
R5638:Fndc7 UTSW 3 108862892 missense possibly damaging 0.69
R5846:Fndc7 UTSW 3 108881391 missense probably damaging 1.00
R6488:Fndc7 UTSW 3 108870575 missense probably damaging 0.99
R6737:Fndc7 UTSW 3 108872278 missense probably damaging 1.00
R6993:Fndc7 UTSW 3 108876591 missense probably benign 0.00
R6998:Fndc7 UTSW 3 108876648 missense probably benign 0.02
R6999:Fndc7 UTSW 3 108876648 missense probably benign 0.02
R7000:Fndc7 UTSW 3 108876648 missense probably benign 0.02
R7001:Fndc7 UTSW 3 108876648 missense probably benign 0.02
R7181:Fndc7 UTSW 3 108881324 critical splice donor site probably null
R7324:Fndc7 UTSW 3 108872221 missense probably benign 0.06
R7425:Fndc7 UTSW 3 108876659 missense probably benign 0.00
R7631:Fndc7 UTSW 3 108869252 missense probably damaging 1.00
R7702:Fndc7 UTSW 3 108862813 missense probably damaging 0.98
R7713:Fndc7 UTSW 3 108870663 missense possibly damaging 0.90
R7909:Fndc7 UTSW 3 108862916 missense probably benign 0.04
R7946:Fndc7 UTSW 3 108872136 missense possibly damaging 0.78
R8023:Fndc7 UTSW 3 108867145 missense probably damaging 1.00
Z1088:Fndc7 UTSW 3 108883500 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCTGTAGACCAGGCTGG -3'
(R):5'- CTATAGGTGTCTGTTGCCCAC -3'

Sequencing Primer
(F):5'- GCTGGCCTCGAACTCAGAAATC -3'
(R):5'- CCACTGGGGGTCAAATTATATAGGC -3'
Posted On2016-06-15