Mutagenetix > Incidental Mutations

Incidental Mutation 'R5042:Npr2'

393242

Institutional Source

Beutler Lab

Gene Symbol

Npr2

Ensembl Gene

ENSMUSG00000028469

Gene Name

natriuretic peptide receptor 2

Synonyms

pwe, cn, guanylyl cyclase-B

MMRRC Submission

042632-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.869) question?

Stock #

R5042 (G1)

Quality Score

175

Status

Validated

Chromosome

Chromosomal Location

43631935-43651244 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 43647002 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 712 (I712F)

Ref Sequence

ENSEMBL: ENSMUSP00000103506 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030191] [ENSMUST00000084646] [ENSMUST00000107870] [ENSMUST00000107874]

Predicted Effect

probably damaging
Transcript: ENSMUST00000030191
AA Change: I712F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000030191
Gene: ENSMUSG00000028469
AA Change: I712F

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	44	399	1.9e-45	PFAM
Pfam:Pkinase_Tyr	518	786	4.7e-39	PFAM
Pfam:Pkinase	535	785	1.2e-32	PFAM
CYCc	825	1019	3.28e-111	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000084646

SMART Domains

Protein: ENSMUSP00000081696
Gene: ENSMUSG00000066196

Domain	Start	End	E-Value	Type
low complexity region	26	48	N/A	INTRINSIC
low complexity region	121	145	N/A	INTRINSIC
low complexity region	148	175	N/A	INTRINSIC
low complexity region	230	254	N/A	INTRINSIC
low complexity region	303	316	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107870

SMART Domains

Protein: ENSMUSP00000103502
Gene: ENSMUSG00000066196

Domain	Start	End	E-Value	Type
low complexity region	26	48	N/A	INTRINSIC
low complexity region	121	145	N/A	INTRINSIC
low complexity region	148	175	N/A	INTRINSIC
low complexity region	230	254	N/A	INTRINSIC
low complexity region	303	316	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107874
AA Change: I712F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103506
Gene: ENSMUSG00000028469
AA Change: I712F

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	44	399	5.7e-56	PFAM
Pfam:Pkinase_Tyr	518	786	4.1e-39	PFAM
Pfam:Pkinase	533	785	3.8e-34	PFAM
CYCc	825	989	4.37e-57	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123351

SMART Domains

Protein: ENSMUSP00000117761
Gene: ENSMUSG00000028469

Domain	Start	End	E-Value	Type
transmembrane domain	28	50	N/A	INTRINSIC
Pfam:Pkinase_Tyr	71	173	1.3e-12	PFAM
Pfam:Pkinase	85	170	1.2e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123883

Predicted Effect

unknown
Transcript: ENSMUST00000128549
AA Change: I277F

SMART Domains

Protein: ENSMUSP00000114385
Gene: ENSMUSG00000028469
AA Change: I277F

Domain	Start	End	E-Value	Type
transmembrane domain	21	43	N/A	INTRINSIC
Pfam:Pkinase_Tyr	84	352	1e-39	PFAM
Pfam:Pkinase	101	351	2.6e-33	PFAM
CYCc	391	585	3.28e-111	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130093

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143160

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144418

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145817

Predicted Effect

probably benign
Transcript: ENSMUST00000149575

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151603

Meta Mutation Damage Score

0.9626

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 89.8%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes natriuretic peptide receptor B, one of two integral membrane receptors for natriuretic peptides. Both NPR1 and NPR2 contain five functional domains: an extracellular ligand-binding domain, a single membrane-spanning region, and intracellularly a protein kinase homology domain, a helical hinge region involved in oligomerization, and a carboxyl-terminal guanylyl cyclase catalytic domain. The protein is the primary receptor for C-type natriuretic peptide (CNP), which upon ligand binding exhibits greatly increased guanylyl cyclase activity. Mutations in this gene are the cause of acromesomelic dysplasia Maroteaux type. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in skeletal abnormalities, malocclusion, and reduced viability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	T	A	7: 29,574,502		noncoding transcript	Het
4933413J09Rik	C	A	14: 26,376,281		noncoding transcript	Het
Aldh1a2	A	G	9: 71,285,004	I413V	possibly damaging	Het
Alpk2	C	T	18: 65,350,508	W143*	probably null	Het
Anpep	G	T	7: 79,839,469	N318K	probably benign	Het
Art5	A	T	7: 102,099,465	L10H	probably damaging	Het
Atg2b	T	G	12: 105,621,262	H1981P	probably benign	Het
B3gnt3	T	C	8: 71,692,888	T279A	probably damaging	Het
Bmp10	G	T	6: 87,434,057	E277D	probably damaging	Het
Ccdc180	A	G	4: 45,916,255	T191A	probably damaging	Het
Dars2	T	A	1: 161,045,094		probably benign	Het
F5	T	A	1: 164,219,451	I2160N	probably damaging	Het
Fndc7	A	T	3: 108,862,786	V608D	probably damaging	Het
Gad1-ps	A	T	10: 99,445,654		noncoding transcript	Het
Gbp2b	A	G	3: 142,611,463	K527E	probably benign	Het
Gm10719	T	A	9: 3,018,970	F72I	probably damaging	Het
Hes3	T	A	4: 152,287,043	S150C	possibly damaging	Het
Hp1bp3	T	A	4: 138,222,108	M1K	probably null	Het
Il17rd	T	A	14: 27,096,041	V229E	probably damaging	Het
Iqch	A	G	9: 63,496,234	M634T	possibly damaging	Het
Magel2	C	T	7: 62,379,606	R753W	unknown	Het
Med26	A	G	8: 72,497,075	V60A	probably damaging	Het
Myo1d	T	A	11: 80,557,521	D926V	probably damaging	Het
Nat1	T	G	8: 67,491,576	D201E	probably benign	Het
Nav3	G	T	10: 109,769,268	S981R	probably benign	Het
Nbn	C	A	4: 15,981,446	L513M	probably benign	Het
Nfatc3	T	C	8: 106,108,125	V701A	probably benign	Het
Nlrp9a	A	G	7: 26,571,278	D911G	probably damaging	Het
Olfr514	A	G	7: 108,825,471	I176T	possibly damaging	Het
Oplah	G	A	15: 76,305,709	R235*	probably null	Het
Pcdha11	T	A	18: 37,011,596	Y247N	probably damaging	Het
Pcdhga9	A	G	18: 37,737,577	Y153C	probably damaging	Het
Pkd1	A	T	17: 24,569,887	D873V	probably benign	Het
Pnpla1	A	G	17: 28,881,047	N296S	probably benign	Het
Ppfia3	A	G	7: 45,342,341	V839A	probably damaging	Het
Ppm1j	A	T	3: 104,782,720	Q148L	probably null	Het
Prune2	T	A	19: 17,119,797	N888K	possibly damaging	Het
Sh3bgr	A	G	16: 96,205,866	D12G	probably benign	Het
Snph	T	A	2: 151,601,057	I35F	possibly damaging	Het
Spag17	A	T	3: 100,072,149	D1442V	probably damaging	Het
Spidr	T	C	16: 16,118,903	T113A	probably benign	Het
St13	A	T	15: 81,365,492	N349K	probably damaging	Het
Ttll6	C	T	11: 96,154,604	S549F	possibly damaging	Het
Uap1l1	A	T	2: 25,362,085	S473T	possibly damaging	Het
Vmn1r54	T	C	6: 90,269,440	V112A	possibly damaging	Het
Vmn2r57	G	A	7: 41,428,662	S124L	probably benign	Het
Wasf2	A	T	4: 133,176,564	R28W	probably benign	Het
Wwp2	T	A	8: 107,548,485	N417K	possibly damaging	Het
Zc3h13	A	T	14: 75,339,396	D1648V	probably damaging	Het

Other mutations in Npr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Npr2	APN	4	43641612	missense	possibly damaging	0.51
IGL01116:Npr2	APN	4	43640248	missense	probably damaging	0.99
IGL01447:Npr2	APN	4	43640554	missense	possibly damaging	0.93
IGL02412:Npr2	APN	4	43647005	missense	probably damaging	0.97
IGL02449:Npr2	APN	4	43646641	missense	probably damaging	1.00
IGL03120:Npr2	APN	4	43643133	missense	probably damaging	0.99
IGL03351:Npr2	APN	4	43640652	missense	probably benign	0.36
palmer	UTSW	4	43647553	missense	probably damaging	1.00
Plantar	UTSW	4	43640597	missense	probably damaging	1.00
R0066:Npr2	UTSW	4	43632329	missense	probably benign	0.00
R0201:Npr2	UTSW	4	43641617	missense	probably damaging	0.98
R0309:Npr2	UTSW	4	43640904	unclassified	probably benign
R0437:Npr2	UTSW	4	43648082	missense	probably damaging	1.00
R0440:Npr2	UTSW	4	43650315	missense	probably damaging	0.99
R0464:Npr2	UTSW	4	43640597	splice site	probably null
R0511:Npr2	UTSW	4	43632801	missense	probably benign	0.00
R0576:Npr2	UTSW	4	43640947	missense	probably benign	0.01
R0630:Npr2	UTSW	4	43641219	missense	probably benign	0.18
R0690:Npr2	UTSW	4	43646991	missense	probably damaging	0.98
R1079:Npr2	UTSW	4	43643654	missense	probably damaging	1.00
R1140:Npr2	UTSW	4	43648353	missense	possibly damaging	0.87
R1171:Npr2	UTSW	4	43647260	missense	possibly damaging	0.52
R1741:Npr2	UTSW	4	43643350	missense	probably damaging	1.00
R1848:Npr2	UTSW	4	43632384	missense	probably benign
R1864:Npr2	UTSW	4	43641258	missense	probably benign	0.30
R1919:Npr2	UTSW	4	43640578	missense	probably damaging	1.00
R2054:Npr2	UTSW	4	43646560	missense	probably damaging	0.99
R2106:Npr2	UTSW	4	43644329	missense	probably damaging	1.00
R2143:Npr2	UTSW	4	43648166	missense	probably damaging	1.00
R2306:Npr2	UTSW	4	43633609	missense	probably damaging	1.00
R2372:Npr2	UTSW	4	43650432	missense	probably damaging	1.00
R2889:Npr2	UTSW	4	43641600	missense	probably benign	0.26
R3076:Npr2	UTSW	4	43640182	missense	probably damaging	1.00
R3078:Npr2	UTSW	4	43640182	missense	probably damaging	1.00
R3711:Npr2	UTSW	4	43643378	missense	probably benign	0.00
R3730:Npr2	UTSW	4	43640999	missense	possibly damaging	0.93
R4301:Npr2	UTSW	4	43641332	critical splice donor site	probably null
R4352:Npr2	UTSW	4	43646592	missense	probably damaging	1.00
R4412:Npr2	UTSW	4	43644150	missense	probably damaging	0.99
R4583:Npr2	UTSW	4	43633522	splice site	probably null
R4593:Npr2	UTSW	4	43647323	unclassified	probably benign
R5213:Npr2	UTSW	4	43640673	critical splice donor site	probably null
R5546:Npr2	UTSW	4	43650150	missense	probably damaging	1.00
R5784:Npr2	UTSW	4	43632801	missense	probably benign	0.00
R5787:Npr2	UTSW	4	43633593	missense	possibly damaging	0.69
R6364:Npr2	UTSW	4	43643622	missense	probably damaging	1.00
R6925:Npr2	UTSW	4	43647553	missense	probably damaging	1.00
R6949:Npr2	UTSW	4	43640597	missense	probably damaging	1.00
R7380:Npr2	UTSW	4	43641254	missense	probably damaging	1.00
R7432:Npr2	UTSW	4	43647155	missense	probably damaging	0.96
R7500:Npr2	UTSW	4	43650415	missense	probably damaging	1.00
R8235:Npr2	UTSW	4	43641603	missense	probably benign	0.09
R8292:Npr2	UTSW	4	43643086	missense	possibly damaging	0.70
Z1176:Npr2	UTSW	4	43650720	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGTCACCCTTCAAGCCTTG -3'
(R):5'- ATACGGCCTCTGACCATTCC -3'

Sequencing Primer
(F):5'- TCGTTTCTTCCCGGGGAG -3'
(R):5'- CGCACCTTCTGGACAATCTCTAAG -3'

Posted On

2016-06-15