Incidental Mutation 'R5042:Bmp10'
ID393247
Institutional Source Beutler Lab
Gene Symbol Bmp10
Ensembl Gene ENSMUSG00000030046
Gene Namebone morphogenetic protein 10
Synonyms
MMRRC Submission 042632-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5042 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location87428994-87437677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87434057 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 277 (E277D)
Ref Sequence ENSEMBL: ENSMUSP00000032125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032125]
Predicted Effect probably damaging
Transcript: ENSMUST00000032125
AA Change: E277D

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032125
Gene: ENSMUSG00000030046
AA Change: E277D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TGFb_propeptide 52 256 8.1e-24 PFAM
TGFB 320 420 6.7e-52 SMART
Meta Mutation Damage Score 0.0682 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate the mature protein, which binds to the activin receptor-like kinase 1 (ALK1) and plays important roles in cardiovascular development including cardiomyocyte proliferation and regulation of heart size, closure of the ductus arteriosus, angiogenesis and ventricular trabeculation. Homozygous knockout mice for this gene exhibit impaired heart development and embryonic lethality. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice display decreased embryo size, cardiac dysgenesis, defects in early embryonic vascular development, enlarged pericardium, arteriovenous malformations, and embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,502 noncoding transcript Het
4933413J09Rik C A 14: 26,376,281 noncoding transcript Het
Aldh1a2 A G 9: 71,285,004 I413V possibly damaging Het
Alpk2 C T 18: 65,350,508 W143* probably null Het
Anpep G T 7: 79,839,469 N318K probably benign Het
Art5 A T 7: 102,099,465 L10H probably damaging Het
Atg2b T G 12: 105,621,262 H1981P probably benign Het
B3gnt3 T C 8: 71,692,888 T279A probably damaging Het
Ccdc180 A G 4: 45,916,255 T191A probably damaging Het
Dars2 T A 1: 161,045,094 probably benign Het
F5 T A 1: 164,219,451 I2160N probably damaging Het
Fndc7 A T 3: 108,862,786 V608D probably damaging Het
Gad1-ps A T 10: 99,445,654 noncoding transcript Het
Gbp2b A G 3: 142,611,463 K527E probably benign Het
Gm10719 T A 9: 3,018,970 F72I probably damaging Het
Hes3 T A 4: 152,287,043 S150C possibly damaging Het
Hp1bp3 T A 4: 138,222,108 M1K probably null Het
Il17rd T A 14: 27,096,041 V229E probably damaging Het
Iqch A G 9: 63,496,234 M634T possibly damaging Het
Magel2 C T 7: 62,379,606 R753W unknown Het
Med26 A G 8: 72,497,075 V60A probably damaging Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Nat1 T G 8: 67,491,576 D201E probably benign Het
Nav3 G T 10: 109,769,268 S981R probably benign Het
Nbn C A 4: 15,981,446 L513M probably benign Het
Nfatc3 T C 8: 106,108,125 V701A probably benign Het
Nlrp9a A G 7: 26,571,278 D911G probably damaging Het
Npr2 A T 4: 43,647,002 I712F probably damaging Het
Olfr514 A G 7: 108,825,471 I176T possibly damaging Het
Oplah G A 15: 76,305,709 R235* probably null Het
Pcdha11 T A 18: 37,011,596 Y247N probably damaging Het
Pcdhga9 A G 18: 37,737,577 Y153C probably damaging Het
Pkd1 A T 17: 24,569,887 D873V probably benign Het
Pnpla1 A G 17: 28,881,047 N296S probably benign Het
Ppfia3 A G 7: 45,342,341 V839A probably damaging Het
Ppm1j A T 3: 104,782,720 Q148L probably null Het
Prune2 T A 19: 17,119,797 N888K possibly damaging Het
Sh3bgr A G 16: 96,205,866 D12G probably benign Het
Snph T A 2: 151,601,057 I35F possibly damaging Het
Spag17 A T 3: 100,072,149 D1442V probably damaging Het
Spidr T C 16: 16,118,903 T113A probably benign Het
St13 A T 15: 81,365,492 N349K probably damaging Het
Ttll6 C T 11: 96,154,604 S549F possibly damaging Het
Uap1l1 A T 2: 25,362,085 S473T possibly damaging Het
Vmn1r54 T C 6: 90,269,440 V112A possibly damaging Het
Vmn2r57 G A 7: 41,428,662 S124L probably benign Het
Wasf2 A T 4: 133,176,564 R28W probably benign Het
Wwp2 T A 8: 107,548,485 N417K possibly damaging Het
Zc3h13 A T 14: 75,339,396 D1648V probably damaging Het
Other mutations in Bmp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Bmp10 APN 6 87429160 missense possibly damaging 0.87
IGL00946:Bmp10 APN 6 87434362 missense probably damaging 1.00
IGL01483:Bmp10 APN 6 87433951 missense probably damaging 1.00
IGL02132:Bmp10 APN 6 87434148 missense probably benign
R1391:Bmp10 UTSW 6 87433758 missense probably benign 0.00
R1472:Bmp10 UTSW 6 87433797 missense probably benign 0.34
R1938:Bmp10 UTSW 6 87433720 missense possibly damaging 0.77
R2114:Bmp10 UTSW 6 87434459 missense probably benign 0.10
R2158:Bmp10 UTSW 6 87434080 missense probably benign 0.21
R4922:Bmp10 UTSW 6 87433575 missense probably benign 0.00
R6041:Bmp10 UTSW 6 87434320 missense probably damaging 1.00
R7000:Bmp10 UTSW 6 87434193 missense probably benign 0.02
R7593:Bmp10 UTSW 6 87433669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGACGTCACAGATGCCACC -3'
(R):5'- ACCCAATCTCCTTGAAGTCG -3'

Sequencing Primer
(F):5'- AGATGCCACCAGACGTTG -3'
(R):5'- CCAATCTCCTTGAAGTCGATGTATAG -3'
Posted On2016-06-15