Incidental Mutation 'R5042:Anpep'
ID393255
Institutional Source Beutler Lab
Gene Symbol Anpep
Ensembl Gene ENSMUSG00000039062
Gene Namealanyl (membrane) aminopeptidase
Synonymsaminopeptidase N, Cd13, Apn
MMRRC Submission 042632-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5042 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location79821803-79861059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 79839469 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 318 (N318K)
Ref Sequence ENSEMBL: ENSMUSP00000103015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049004] [ENSMUST00000107392] [ENSMUST00000205502] [ENSMUST00000206235]
Predicted Effect probably benign
Transcript: ENSMUST00000049004
AA Change: N318K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000035943
Gene: ENSMUSG00000039062
AA Change: N318K

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 44 64 N/A INTRINSIC
Pfam:Peptidase_M1 75 479 6.3e-142 PFAM
Pfam:Peptidase_MA_2 355 502 1.4e-21 PFAM
Pfam:ERAP1_C 618 944 2.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107392
AA Change: N318K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000103015
Gene: ENSMUSG00000039062
AA Change: N318K

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 44 64 N/A INTRINSIC
Pfam:Peptidase_M1 75 479 2.5e-139 PFAM
Pfam:ERAP1_C 618 943 2e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149164
Predicted Effect probably benign
Transcript: ENSMUST00000205502
Predicted Effect probably benign
Transcript: ENSMUST00000206235
Meta Mutation Damage Score 0.2234 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminopeptidase N is located in the small-intestinal and renal microvillar membrane, and also in other plasma membranes. In the small intestine aminopeptidase N plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases. Its function in proximal tubular epithelial cells and other cell types is less clear. The large extracellular carboxyterminal domain contains a pentapeptide consensus sequence characteristic of members of the zinc-binding metalloproteinase superfamily. Sequence comparisons with known enzymes of this class showed that CD13 and aminopeptidase N are identical. The latter enzyme was thought to be involved in the metabolism of regulatory peptides by diverse cell types, including small intestinal and renal tubular epithelial cells, macrophages, granulocytes, and synaptic membranes from the CNS. Human aminopeptidase N is a receptor for one strain of human coronavirus that is an important cause of upper respiratory tract infections. Defects in this gene appear to be a cause of various types of leukemia or lymphoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for different knock-out alleles exhibit an increase in CD4+ thymocytes, altered macrophage adhesion, pathological neovascularization and/or altered mammary gland morphology during gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,502 noncoding transcript Het
4933413J09Rik C A 14: 26,376,281 noncoding transcript Het
Aldh1a2 A G 9: 71,285,004 I413V possibly damaging Het
Alpk2 C T 18: 65,350,508 W143* probably null Het
Art5 A T 7: 102,099,465 L10H probably damaging Het
Atg2b T G 12: 105,621,262 H1981P probably benign Het
B3gnt3 T C 8: 71,692,888 T279A probably damaging Het
Bmp10 G T 6: 87,434,057 E277D probably damaging Het
Ccdc180 A G 4: 45,916,255 T191A probably damaging Het
Dars2 T A 1: 161,045,094 probably benign Het
F5 T A 1: 164,219,451 I2160N probably damaging Het
Fndc7 A T 3: 108,862,786 V608D probably damaging Het
Gad1-ps A T 10: 99,445,654 noncoding transcript Het
Gbp2b A G 3: 142,611,463 K527E probably benign Het
Gm10719 T A 9: 3,018,970 F72I probably damaging Het
Hes3 T A 4: 152,287,043 S150C possibly damaging Het
Hp1bp3 T A 4: 138,222,108 M1K probably null Het
Il17rd T A 14: 27,096,041 V229E probably damaging Het
Iqch A G 9: 63,496,234 M634T possibly damaging Het
Magel2 C T 7: 62,379,606 R753W unknown Het
Med26 A G 8: 72,497,075 V60A probably damaging Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Nat1 T G 8: 67,491,576 D201E probably benign Het
Nav3 G T 10: 109,769,268 S981R probably benign Het
Nbn C A 4: 15,981,446 L513M probably benign Het
Nfatc3 T C 8: 106,108,125 V701A probably benign Het
Nlrp9a A G 7: 26,571,278 D911G probably damaging Het
Npr2 A T 4: 43,647,002 I712F probably damaging Het
Olfr514 A G 7: 108,825,471 I176T possibly damaging Het
Oplah G A 15: 76,305,709 R235* probably null Het
Pcdha11 T A 18: 37,011,596 Y247N probably damaging Het
Pcdhga9 A G 18: 37,737,577 Y153C probably damaging Het
Pkd1 A T 17: 24,569,887 D873V probably benign Het
Pnpla1 A G 17: 28,881,047 N296S probably benign Het
Ppfia3 A G 7: 45,342,341 V839A probably damaging Het
Ppm1j A T 3: 104,782,720 Q148L probably null Het
Prune2 T A 19: 17,119,797 N888K possibly damaging Het
Sh3bgr A G 16: 96,205,866 D12G probably benign Het
Snph T A 2: 151,601,057 I35F possibly damaging Het
Spag17 A T 3: 100,072,149 D1442V probably damaging Het
Spidr T C 16: 16,118,903 T113A probably benign Het
St13 A T 15: 81,365,492 N349K probably damaging Het
Ttll6 C T 11: 96,154,604 S549F possibly damaging Het
Uap1l1 A T 2: 25,362,085 S473T possibly damaging Het
Vmn1r54 T C 6: 90,269,440 V112A possibly damaging Het
Vmn2r57 G A 7: 41,428,662 S124L probably benign Het
Wasf2 A T 4: 133,176,564 R28W probably benign Het
Wwp2 T A 8: 107,548,485 N417K possibly damaging Het
Zc3h13 A T 14: 75,339,396 D1648V probably damaging Het
Other mutations in Anpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Anpep APN 7 79825736 missense possibly damaging 0.64
IGL00089:Anpep APN 7 79841986 missense probably damaging 1.00
IGL00767:Anpep APN 7 79840890 missense probably benign 0.00
IGL00901:Anpep APN 7 79839423 missense probably benign
IGL01919:Anpep APN 7 79825350 missense possibly damaging 0.77
IGL02049:Anpep APN 7 79835181 missense probably damaging 0.97
IGL02195:Anpep APN 7 79826685 missense probably damaging 1.00
IGL02210:Anpep APN 7 79826904 missense probably benign 0.00
IGL02584:Anpep APN 7 79825393 splice site probably benign
IGL02677:Anpep APN 7 79838730 missense probably damaging 1.00
IGL03073:Anpep APN 7 79838955 missense probably damaging 1.00
IGL03100:Anpep APN 7 79836361 missense probably benign 0.01
PIT4696001:Anpep UTSW 7 79839464 missense possibly damaging 0.85
R0329:Anpep UTSW 7 79838256 missense probably benign 0.01
R0330:Anpep UTSW 7 79838256 missense probably benign 0.01
R0619:Anpep UTSW 7 79841009 missense probably benign
R0691:Anpep UTSW 7 79839299 missense probably damaging 0.98
R1004:Anpep UTSW 7 79838256 missense probably benign 0.01
R1005:Anpep UTSW 7 79838256 missense probably benign 0.01
R1274:Anpep UTSW 7 79838256 missense probably benign 0.01
R1288:Anpep UTSW 7 79838256 missense probably benign 0.01
R1289:Anpep UTSW 7 79838256 missense probably benign 0.01
R1532:Anpep UTSW 7 79826948 nonsense probably null
R1540:Anpep UTSW 7 79838256 missense probably benign 0.01
R1574:Anpep UTSW 7 79838407 splice site probably null
R1574:Anpep UTSW 7 79838407 splice site probably null
R1618:Anpep UTSW 7 79835417 missense probably benign 0.00
R1627:Anpep UTSW 7 79842011 missense probably benign
R1693:Anpep UTSW 7 79838256 missense probably benign 0.01
R1717:Anpep UTSW 7 79838256 missense probably benign 0.01
R1745:Anpep UTSW 7 79838256 missense probably benign 0.01
R1746:Anpep UTSW 7 79838256 missense probably benign 0.01
R1748:Anpep UTSW 7 79838256 missense probably benign 0.01
R1809:Anpep UTSW 7 79841823 missense probably benign 0.01
R1901:Anpep UTSW 7 79838256 missense probably benign 0.01
R1902:Anpep UTSW 7 79838256 missense probably benign 0.01
R1903:Anpep UTSW 7 79838256 missense probably benign 0.01
R1985:Anpep UTSW 7 79840857 splice site probably null
R2379:Anpep UTSW 7 79841218 missense probably benign 0.28
R2508:Anpep UTSW 7 79838291 missense possibly damaging 0.80
R3110:Anpep UTSW 7 79841972 missense probably benign 0.15
R3112:Anpep UTSW 7 79841972 missense probably benign 0.15
R3898:Anpep UTSW 7 79839225 missense probably benign 0.07
R3899:Anpep UTSW 7 79839225 missense probably benign 0.07
R3900:Anpep UTSW 7 79839225 missense probably benign 0.07
R4211:Anpep UTSW 7 79840996 nonsense probably null
R4701:Anpep UTSW 7 79839465 missense probably benign 0.16
R4716:Anpep UTSW 7 79826632 missense probably benign 0.00
R5020:Anpep UTSW 7 79833727 missense probably benign
R5084:Anpep UTSW 7 79826870 critical splice donor site probably null
R5319:Anpep UTSW 7 79841731 missense probably benign
R5593:Anpep UTSW 7 79842046 missense probably benign 0.04
R5778:Anpep UTSW 7 79836391 missense probably benign 0.00
R5852:Anpep UTSW 7 79838972 nonsense probably null
R5906:Anpep UTSW 7 79833675 missense probably benign
R6164:Anpep UTSW 7 79842205 missense possibly damaging 0.68
R6254:Anpep UTSW 7 79839233 missense probably damaging 1.00
R6284:Anpep UTSW 7 79825802 missense probably damaging 1.00
R6380:Anpep UTSW 7 79841896 missense probably benign 0.04
R6594:Anpep UTSW 7 79841361 splice site probably null
R6746:Anpep UTSW 7 79839185 splice site probably null
R6920:Anpep UTSW 7 79825349 missense probably damaging 1.00
R7060:Anpep UTSW 7 79841794 missense probably benign 0.33
R7072:Anpep UTSW 7 79835379 missense possibly damaging 0.58
R7095:Anpep UTSW 7 79842202 missense possibly damaging 0.87
R7102:Anpep UTSW 7 79836313 missense probably benign 0.00
R7178:Anpep UTSW 7 79840988 missense probably benign
R7223:Anpep UTSW 7 79825310 missense probably damaging 1.00
R7344:Anpep UTSW 7 79838650 missense possibly damaging 0.60
R7441:Anpep UTSW 7 79827644 missense possibly damaging 0.93
R7479:Anpep UTSW 7 79835370 missense probably benign 0.11
R7503:Anpep UTSW 7 79826637 missense probably damaging 1.00
R7683:Anpep UTSW 7 79839198 missense probably damaging 0.98
R7912:Anpep UTSW 7 79838426 missense probably benign 0.00
R7935:Anpep UTSW 7 79826961 missense possibly damaging 0.46
R8036:Anpep UTSW 7 79841898 missense probably benign 0.11
R8039:Anpep UTSW 7 79839400 critical splice donor site probably null
Z1176:Anpep UTSW 7 79827639 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCAAAGACCAGGGAGCTCTCAC -3'
(R):5'- GTTGGTCTCCATCCTGACTTATCAG -3'

Sequencing Primer
(F):5'- ATGGCTCCAGCGTTGAAGTC -3'
(R):5'- TGACTTATCAGGGACCTCTAGC -3'
Posted On2016-06-15