Incidental Mutation 'R5042:Art5'
ID393256
Institutional Source Beutler Lab
Gene Symbol Art5
Ensembl Gene ENSMUSG00000070424
Gene NameADP-ribosyltransferase 5
SynonymsYac-2
MMRRC Submission 042632-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5042 (G1)
Quality Score141
Status Validated
Chromosome7
Chromosomal Location102096879-102109489 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102099465 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 10 (L10H)
Ref Sequence ENSEMBL: ENSMUSP00000102550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033300] [ENSMUST00000084843] [ENSMUST00000094128] [ENSMUST00000106934] [ENSMUST00000106935] [ENSMUST00000106937] [ENSMUST00000123372] [ENSMUST00000124189] [ENSMUST00000139104] [ENSMUST00000209809] [ENSMUST00000210211]
Predicted Effect probably benign
Transcript: ENSMUST00000033300
SMART Domains Protein: ENSMUSP00000033300
Gene: ENSMUSG00000030996

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ART 39 269 2e-99 PFAM
low complexity region 288 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084843
SMART Domains Protein: ENSMUSP00000081903
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 150 1.4e-54 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
low complexity region 345 362 N/A INTRINSIC
low complexity region 403 415 N/A INTRINSIC
low complexity region 416 428 N/A INTRINSIC
ANK 439 469 1.58e3 SMART
low complexity region 484 496 N/A INTRINSIC
ANK 522 551 1.74e0 SMART
Pfam:TRP_2 557 619 1e-24 PFAM
Pfam:Ion_trans 716 1024 1.7e-24 PFAM
Pfam:PKD_channel 774 1019 2.4e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
coiled coil region 1122 1162 N/A INTRINSIC
low complexity region 1220 1236 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094128
AA Change: L10H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091678
Gene: ENSMUSG00000070424
AA Change: L10H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 255 3.6e-96 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106934
AA Change: L10H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102547
Gene: ENSMUSG00000070424
AA Change: L10H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 117 3.7e-29 PFAM
Pfam:ART 114 157 6.5e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106935
AA Change: L10H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102548
Gene: ENSMUSG00000070424
AA Change: L10H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 146 2.1e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106937
AA Change: L10H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102550
Gene: ENSMUSG00000070424
AA Change: L10H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 255 1.9e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123372
SMART Domains Protein: ENSMUSP00000121068
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 152 5.2e-29 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
internal_repeat_1 324 345 2.69e-6 PROSPERO
low complexity region 346 379 N/A INTRINSIC
internal_repeat_1 380 401 2.69e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000124189
SMART Domains Protein: ENSMUSP00000116934
Gene: ENSMUSG00000100254

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
low complexity region 42 54 N/A INTRINSIC
ANK 65 95 1.58e3 SMART
low complexity region 110 122 N/A INTRINSIC
ANK 148 177 1.74e0 SMART
Pfam:TRP_2 183 245 9.1e-29 PFAM
transmembrane domain 345 367 N/A INTRINSIC
Pfam:PKD_channel 398 645 1.4e-12 PFAM
Pfam:Ion_trans 422 638 1e-31 PFAM
low complexity region 696 707 N/A INTRINSIC
low complexity region 719 730 N/A INTRINSIC
coiled coil region 748 788 N/A INTRINSIC
low complexity region 846 862 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139104
SMART Domains Protein: ENSMUSP00000122430
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 62 3.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155078
SMART Domains Protein: ENSMUSP00000123466
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 62 4.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209809
Predicted Effect probably benign
Transcript: ENSMUST00000210211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211553
Meta Mutation Damage Score 0.4307 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ARG-specific ADP-ribosyltransferase family. Proteins in this family regulate the function of target proteins by attaching ADP-ribose to specific amino acid residues in their target proteins. The mouse homolog lacks a glycosylphosphatidylinositol-anchor signal sequence and is predicted to be a secretory enzyme. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,502 noncoding transcript Het
4933413J09Rik C A 14: 26,376,281 noncoding transcript Het
Aldh1a2 A G 9: 71,285,004 I413V possibly damaging Het
Alpk2 C T 18: 65,350,508 W143* probably null Het
Anpep G T 7: 79,839,469 N318K probably benign Het
Atg2b T G 12: 105,621,262 H1981P probably benign Het
B3gnt3 T C 8: 71,692,888 T279A probably damaging Het
Bmp10 G T 6: 87,434,057 E277D probably damaging Het
Ccdc180 A G 4: 45,916,255 T191A probably damaging Het
Dars2 T A 1: 161,045,094 probably benign Het
F5 T A 1: 164,219,451 I2160N probably damaging Het
Fndc7 A T 3: 108,862,786 V608D probably damaging Het
Gad1-ps A T 10: 99,445,654 noncoding transcript Het
Gbp2b A G 3: 142,611,463 K527E probably benign Het
Gm10719 T A 9: 3,018,970 F72I probably damaging Het
Hes3 T A 4: 152,287,043 S150C possibly damaging Het
Hp1bp3 T A 4: 138,222,108 M1K probably null Het
Il17rd T A 14: 27,096,041 V229E probably damaging Het
Iqch A G 9: 63,496,234 M634T possibly damaging Het
Magel2 C T 7: 62,379,606 R753W unknown Het
Med26 A G 8: 72,497,075 V60A probably damaging Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Nat1 T G 8: 67,491,576 D201E probably benign Het
Nav3 G T 10: 109,769,268 S981R probably benign Het
Nbn C A 4: 15,981,446 L513M probably benign Het
Nfatc3 T C 8: 106,108,125 V701A probably benign Het
Nlrp9a A G 7: 26,571,278 D911G probably damaging Het
Npr2 A T 4: 43,647,002 I712F probably damaging Het
Olfr514 A G 7: 108,825,471 I176T possibly damaging Het
Oplah G A 15: 76,305,709 R235* probably null Het
Pcdha11 T A 18: 37,011,596 Y247N probably damaging Het
Pcdhga9 A G 18: 37,737,577 Y153C probably damaging Het
Pkd1 A T 17: 24,569,887 D873V probably benign Het
Pnpla1 A G 17: 28,881,047 N296S probably benign Het
Ppfia3 A G 7: 45,342,341 V839A probably damaging Het
Ppm1j A T 3: 104,782,720 Q148L probably null Het
Prune2 T A 19: 17,119,797 N888K possibly damaging Het
Sh3bgr A G 16: 96,205,866 D12G probably benign Het
Snph T A 2: 151,601,057 I35F possibly damaging Het
Spag17 A T 3: 100,072,149 D1442V probably damaging Het
Spidr T C 16: 16,118,903 T113A probably benign Het
St13 A T 15: 81,365,492 N349K probably damaging Het
Ttll6 C T 11: 96,154,604 S549F possibly damaging Het
Uap1l1 A T 2: 25,362,085 S473T possibly damaging Het
Vmn1r54 T C 6: 90,269,440 V112A possibly damaging Het
Vmn2r57 G A 7: 41,428,662 S124L probably benign Het
Wasf2 A T 4: 133,176,564 R28W probably benign Het
Wwp2 T A 8: 107,548,485 N417K possibly damaging Het
Zc3h13 A T 14: 75,339,396 D1648V probably damaging Het
Other mutations in Art5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:Art5 APN 7 102097916 missense probably null
IGL02507:Art5 APN 7 102099492 start codon destroyed probably null 0.83
IGL03143:Art5 APN 7 102097897 missense probably damaging 1.00
R0632:Art5 UTSW 7 102097957 missense probably damaging 1.00
R1215:Art5 UTSW 7 102097909 missense probably damaging 0.99
R2151:Art5 UTSW 7 102098200 missense possibly damaging 0.71
R2152:Art5 UTSW 7 102098200 missense possibly damaging 0.71
R2153:Art5 UTSW 7 102098200 missense possibly damaging 0.71
R4533:Art5 UTSW 7 102098338 missense probably benign
R4719:Art5 UTSW 7 102098494 unclassified probably null
R5098:Art5 UTSW 7 102097970 missense probably damaging 0.98
R5341:Art5 UTSW 7 102098099 missense probably benign 0.01
R6037:Art5 UTSW 7 102098384 missense probably benign 0.01
R6037:Art5 UTSW 7 102098384 missense probably benign 0.01
R6262:Art5 UTSW 7 102098131 missense probably benign 0.00
R6850:Art5 UTSW 7 102098095 missense possibly damaging 0.60
R7186:Art5 UTSW 7 102097329 missense probably benign
R7270:Art5 UTSW 7 102097873 missense probably damaging 1.00
R7381:Art5 UTSW 7 102098170 missense probably damaging 1.00
R7729:Art5 UTSW 7 102098504 missense possibly damaging 0.51
X0061:Art5 UTSW 7 102098380 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GGCACTTGGATTCCCTAATGG -3'
(R):5'- TAGACTAGGGCTGACATGGG -3'

Sequencing Primer
(F):5'- CCCTAATGGAATAGAAGTTCCTGAG -3'
(R):5'- GGGACAATAAAGTCTGAAGCCACATC -3'
Posted On2016-06-15