Incidental Mutation 'R5042:Olfr514'
ID393257
Institutional Source Beutler Lab
Gene Symbol Olfr514
Ensembl Gene ENSMUSG00000066241
Gene Nameolfactory receptor 514
SynonymsMOR268-1, GA_x6K02T2PBJ9-11156311-11155379
MMRRC Submission 042632-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R5042 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108825065-108825997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108825471 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 176 (I176T)
Ref Sequence ENSEMBL: ENSMUSP00000081807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084754]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084754
AA Change: I176T

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081807
Gene: ENSMUSG00000066241
AA Change: I176T

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 3.9e-57 PFAM
Pfam:7tm_1 40 289 5e-21 PFAM
Meta Mutation Damage Score 0.3671 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,502 noncoding transcript Het
4933413J09Rik C A 14: 26,376,281 noncoding transcript Het
Aldh1a2 A G 9: 71,285,004 I413V possibly damaging Het
Alpk2 C T 18: 65,350,508 W143* probably null Het
Anpep G T 7: 79,839,469 N318K probably benign Het
Art5 A T 7: 102,099,465 L10H probably damaging Het
Atg2b T G 12: 105,621,262 H1981P probably benign Het
B3gnt3 T C 8: 71,692,888 T279A probably damaging Het
Bmp10 G T 6: 87,434,057 E277D probably damaging Het
Ccdc180 A G 4: 45,916,255 T191A probably damaging Het
Dars2 T A 1: 161,045,094 probably benign Het
F5 T A 1: 164,219,451 I2160N probably damaging Het
Fndc7 A T 3: 108,862,786 V608D probably damaging Het
Gad1-ps A T 10: 99,445,654 noncoding transcript Het
Gbp2b A G 3: 142,611,463 K527E probably benign Het
Gm10719 T A 9: 3,018,970 F72I probably damaging Het
Hes3 T A 4: 152,287,043 S150C possibly damaging Het
Hp1bp3 T A 4: 138,222,108 M1K probably null Het
Il17rd T A 14: 27,096,041 V229E probably damaging Het
Iqch A G 9: 63,496,234 M634T possibly damaging Het
Magel2 C T 7: 62,379,606 R753W unknown Het
Med26 A G 8: 72,497,075 V60A probably damaging Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Nat1 T G 8: 67,491,576 D201E probably benign Het
Nav3 G T 10: 109,769,268 S981R probably benign Het
Nbn C A 4: 15,981,446 L513M probably benign Het
Nfatc3 T C 8: 106,108,125 V701A probably benign Het
Nlrp9a A G 7: 26,571,278 D911G probably damaging Het
Npr2 A T 4: 43,647,002 I712F probably damaging Het
Oplah G A 15: 76,305,709 R235* probably null Het
Pcdha11 T A 18: 37,011,596 Y247N probably damaging Het
Pcdhga9 A G 18: 37,737,577 Y153C probably damaging Het
Pkd1 A T 17: 24,569,887 D873V probably benign Het
Pnpla1 A G 17: 28,881,047 N296S probably benign Het
Ppfia3 A G 7: 45,342,341 V839A probably damaging Het
Ppm1j A T 3: 104,782,720 Q148L probably null Het
Prune2 T A 19: 17,119,797 N888K possibly damaging Het
Sh3bgr A G 16: 96,205,866 D12G probably benign Het
Snph T A 2: 151,601,057 I35F possibly damaging Het
Spag17 A T 3: 100,072,149 D1442V probably damaging Het
Spidr T C 16: 16,118,903 T113A probably benign Het
St13 A T 15: 81,365,492 N349K probably damaging Het
Ttll6 C T 11: 96,154,604 S549F possibly damaging Het
Uap1l1 A T 2: 25,362,085 S473T possibly damaging Het
Vmn1r54 T C 6: 90,269,440 V112A possibly damaging Het
Vmn2r57 G A 7: 41,428,662 S124L probably benign Het
Wasf2 A T 4: 133,176,564 R28W probably benign Het
Wwp2 T A 8: 107,548,485 N417K possibly damaging Het
Zc3h13 A T 14: 75,339,396 D1648V probably damaging Het
Other mutations in Olfr514
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Olfr514 APN 7 108825073 missense probably benign 0.00
IGL01469:Olfr514 APN 7 108825327 missense probably benign 0.29
IGL02079:Olfr514 APN 7 108825936 missense probably damaging 0.99
IGL02330:Olfr514 APN 7 108825999 unclassified probably benign
IGL02662:Olfr514 APN 7 108825745 missense probably benign 0.16
IGL02713:Olfr514 APN 7 108825594 missense probably damaging 1.00
R1158:Olfr514 UTSW 7 108825178 missense probably damaging 1.00
R1610:Olfr514 UTSW 7 108825924 missense probably benign
R1638:Olfr514 UTSW 7 108825235 missense probably benign 0.03
R4242:Olfr514 UTSW 7 108825459 missense probably benign
R4630:Olfr514 UTSW 7 108825595 missense probably damaging 1.00
R5967:Olfr514 UTSW 7 108825714 missense probably benign 0.12
R7180:Olfr514 UTSW 7 108825979 missense probably damaging 0.98
Z1088:Olfr514 UTSW 7 108825896 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGTGCTGTAGAAGAGGGTGAC -3'
(R):5'- ATCGATTTGCTGCAATCTGC -3'

Sequencing Primer
(F):5'- GTGGAAAAAGCCTTCTGTCTC -3'
(R):5'- GATTTGCTGCAATCTGCTACCC -3'
Posted On2016-06-15