Incidental Mutation 'R5042:Gad1-ps'
ID 393263
Institutional Source Beutler Lab
Gene Symbol Gad1-ps
Ensembl Gene ENSMUSG00000090665
Gene Name glutamate decarboxylase 1, pseudogene
Synonyms Gad-1ps
MMRRC Submission 042632-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.231) question?
Stock # R5042 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 99279906-99281681 bp(+) (GRCm39)
Type of Mutation exon
DNA Base Change (assembly) A to T at 99281516 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167243
SMART Domains Protein: ENSMUSP00000133048
Gene: ENSMUSG00000090665

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 1 368 4.3e-153 PFAM
Pfam:Beta_elim_lyase 91 436 7.3e-8 PFAM
Pfam:Aminotran_5 130 370 4.7e-7 PFAM
Meta Mutation Damage Score 0.2900 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,273,927 (GRCm39) noncoding transcript Het
4933413J09Rik C A 14: 26,097,436 (GRCm39) noncoding transcript Het
Aldh1a2 A G 9: 71,192,286 (GRCm39) I413V possibly damaging Het
Alpk2 C T 18: 65,483,579 (GRCm39) W143* probably null Het
Anpep G T 7: 79,489,217 (GRCm39) N318K probably benign Het
Art5 A T 7: 101,748,672 (GRCm39) L10H probably damaging Het
Atg2b T G 12: 105,587,521 (GRCm39) H1981P probably benign Het
B3gnt3 T C 8: 72,145,532 (GRCm39) T279A probably damaging Het
Bmp10 G T 6: 87,411,039 (GRCm39) E277D probably damaging Het
Ccdc180 A G 4: 45,916,255 (GRCm39) T191A probably damaging Het
Dars2 T A 1: 160,872,664 (GRCm39) probably benign Het
F5 T A 1: 164,047,020 (GRCm39) I2160N probably damaging Het
Fndc7 A T 3: 108,770,102 (GRCm39) V608D probably damaging Het
Gbp2b A G 3: 142,317,224 (GRCm39) K527E probably benign Het
Gm10719 T A 9: 3,018,970 (GRCm39) F72I probably damaging Het
Hes3 T A 4: 152,371,500 (GRCm39) S150C possibly damaging Het
Hp1bp3 T A 4: 137,949,419 (GRCm39) M1K probably null Het
Il17rd T A 14: 26,817,998 (GRCm39) V229E probably damaging Het
Iqch A G 9: 63,403,516 (GRCm39) M634T possibly damaging Het
Magel2 C T 7: 62,029,354 (GRCm39) R753W unknown Het
Med26 A G 8: 73,250,919 (GRCm39) V60A probably damaging Het
Myo1d T A 11: 80,448,347 (GRCm39) D926V probably damaging Het
Nat1 T G 8: 67,944,228 (GRCm39) D201E probably benign Het
Nav3 G T 10: 109,605,129 (GRCm39) S981R probably benign Het
Nbn C A 4: 15,981,446 (GRCm39) L513M probably benign Het
Nfatc3 T C 8: 106,834,757 (GRCm39) V701A probably benign Het
Nlrp9a A G 7: 26,270,703 (GRCm39) D911G probably damaging Het
Npr2 A T 4: 43,647,002 (GRCm39) I712F probably damaging Het
Oplah G A 15: 76,189,909 (GRCm39) R235* probably null Het
Or10a48 A G 7: 108,424,678 (GRCm39) I176T possibly damaging Het
Pcdha11 T A 18: 37,144,649 (GRCm39) Y247N probably damaging Het
Pcdhga9 A G 18: 37,870,630 (GRCm39) Y153C probably damaging Het
Pkd1 A T 17: 24,788,861 (GRCm39) D873V probably benign Het
Pnpla1 A G 17: 29,100,021 (GRCm39) N296S probably benign Het
Ppfia3 A G 7: 44,991,765 (GRCm39) V839A probably damaging Het
Ppm1j A T 3: 104,690,036 (GRCm39) Q148L probably null Het
Prune2 T A 19: 17,097,161 (GRCm39) N888K possibly damaging Het
Sh3bgr A G 16: 96,007,066 (GRCm39) D12G probably benign Het
Snph T A 2: 151,442,977 (GRCm39) I35F possibly damaging Het
Spag17 A T 3: 99,979,465 (GRCm39) D1442V probably damaging Het
Spidr T C 16: 15,936,767 (GRCm39) T113A probably benign Het
St13 A T 15: 81,249,693 (GRCm39) N349K probably damaging Het
Ttll6 C T 11: 96,045,430 (GRCm39) S549F possibly damaging Het
Uap1l1 A T 2: 25,252,097 (GRCm39) S473T possibly damaging Het
Vmn1r54 T C 6: 90,246,422 (GRCm39) V112A possibly damaging Het
Vmn2r57 G A 7: 41,078,086 (GRCm39) S124L probably benign Het
Wasf2 A T 4: 132,903,875 (GRCm39) R28W probably benign Het
Wwp2 T A 8: 108,275,117 (GRCm39) N417K possibly damaging Het
Zc3h13 A T 14: 75,576,836 (GRCm39) D1648V probably damaging Het
Other mutations in Gad1-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Gad1-ps APN 10 99,281,310 (GRCm39) exon noncoding transcript
IGL01301:Gad1-ps APN 10 99,281,013 (GRCm39) exon noncoding transcript
IGL01394:Gad1-ps APN 10 99,281,424 (GRCm39) exon noncoding transcript
IGL02220:Gad1-ps APN 10 99,281,184 (GRCm39) exon noncoding transcript
IGL02240:Gad1-ps APN 10 99,280,820 (GRCm39) exon noncoding transcript
IGL03406:Gad1-ps APN 10 99,280,641 (GRCm39) exon noncoding transcript
ANU18:Gad1-ps UTSW 10 99,281,013 (GRCm39) exon noncoding transcript
R0305:Gad1-ps UTSW 10 99,280,665 (GRCm39) exon noncoding transcript
R0446:Gad1-ps UTSW 10 99,281,383 (GRCm39) exon noncoding transcript
R0538:Gad1-ps UTSW 10 99,280,854 (GRCm39) exon noncoding transcript
R1511:Gad1-ps UTSW 10 99,281,331 (GRCm39) exon noncoding transcript
R1734:Gad1-ps UTSW 10 99,281,637 (GRCm39) exon noncoding transcript
R1745:Gad1-ps UTSW 10 99,281,386 (GRCm39) exon noncoding transcript
R1886:Gad1-ps UTSW 10 99,281,444 (GRCm39) exon noncoding transcript
R3111:Gad1-ps UTSW 10 99,280,383 (GRCm39) exon noncoding transcript
R3617:Gad1-ps UTSW 10 99,281,260 (GRCm39) exon noncoding transcript
R5223:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5234:Gad1-ps UTSW 10 99,281,188 (GRCm39) exon noncoding transcript
R5275:Gad1-ps UTSW 10 99,280,751 (GRCm39) exon noncoding transcript
R5295:Gad1-ps UTSW 10 99,280,751 (GRCm39) exon noncoding transcript
R5334:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5335:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5336:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5337:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5396:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5397:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5399:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5428:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5429:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5431:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5661:Gad1-ps UTSW 10 99,280,901 (GRCm39) exon noncoding transcript
R5667:Gad1-ps UTSW 10 99,280,395 (GRCm39) exon noncoding transcript
R5671:Gad1-ps UTSW 10 99,280,395 (GRCm39) exon noncoding transcript
R5885:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5886:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- AAAGGGCACTGTGGGATTTG -3'
(R):5'- CCATTCTGGTTCTGCAAAGTG -3'

Sequencing Primer
(F):5'- TCAGATTAACGAGTGCCTGG -3'
(R):5'- GTTCTGCAAAGTGGGATTACAGATC -3'
Posted On 2016-06-15