Mutagenetix > Incidental Mutation

Incidental Mutation 'R5042:Myo1d'

393265

Institutional Source

Beutler Lab

Gene Symbol

Myo1d

Ensembl Gene

ENSMUSG00000035441

Gene Name

myosin ID

Synonyms

9930104H07Rik, D11Ertd9e

MMRRC Submission

042632-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5042 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80482126-80780025 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 80557521 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 926 (D926V)

Ref Sequence

ENSEMBL: ENSMUSP00000037819 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041065]

AlphaFold

Q5SYD0

Predicted Effect

probably damaging
Transcript: ENSMUST00000041065
AA Change: D926V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: D926V

Domain	Start	End	E-Value	Type
MYSc	3	696	N/A	SMART
IQ	697	719	1.46e-3	SMART
Pfam:Myosin_TH1	803	1006	4.1e-49	PFAM

Meta Mutation Damage Score

0.9431

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 89.8%

Validation Efficiency

100% (57/57)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	T	A	7: 29,574,502		noncoding transcript	Het
4933413J09Rik	C	A	14: 26,376,281		noncoding transcript	Het
Aldh1a2	A	G	9: 71,285,004	I413V	possibly damaging	Het
Alpk2	C	T	18: 65,350,508	W143*	probably null	Het
Anpep	G	T	7: 79,839,469	N318K	probably benign	Het
Art5	A	T	7: 102,099,465	L10H	probably damaging	Het
Atg2b	T	G	12: 105,621,262	H1981P	probably benign	Het
B3gnt3	T	C	8: 71,692,888	T279A	probably damaging	Het
Bmp10	G	T	6: 87,434,057	E277D	probably damaging	Het
Ccdc180	A	G	4: 45,916,255	T191A	probably damaging	Het
Dars2	T	A	1: 161,045,094		probably benign	Het
F5	T	A	1: 164,219,451	I2160N	probably damaging	Het
Fndc7	A	T	3: 108,862,786	V608D	probably damaging	Het
Gad1-ps	A	T	10: 99,445,654		noncoding transcript	Het
Gbp2b	A	G	3: 142,611,463	K527E	probably benign	Het
Gm10719	T	A	9: 3,018,970	F72I	probably damaging	Het
Hes3	T	A	4: 152,287,043	S150C	possibly damaging	Het
Hp1bp3	T	A	4: 138,222,108	M1K	probably null	Het
Il17rd	T	A	14: 27,096,041	V229E	probably damaging	Het
Iqch	A	G	9: 63,496,234	M634T	possibly damaging	Het
Magel2	C	T	7: 62,379,606	R753W	unknown	Het
Med26	A	G	8: 72,497,075	V60A	probably damaging	Het
Nat1	T	G	8: 67,491,576	D201E	probably benign	Het
Nav3	G	T	10: 109,769,268	S981R	probably benign	Het
Nbn	C	A	4: 15,981,446	L513M	probably benign	Het
Nfatc3	T	C	8: 106,108,125	V701A	probably benign	Het
Nlrp9a	A	G	7: 26,571,278	D911G	probably damaging	Het
Npr2	A	T	4: 43,647,002	I712F	probably damaging	Het
Olfr514	A	G	7: 108,825,471	I176T	possibly damaging	Het
Oplah	G	A	15: 76,305,709	R235*	probably null	Het
Pcdha11	T	A	18: 37,011,596	Y247N	probably damaging	Het
Pcdhga9	A	G	18: 37,737,577	Y153C	probably damaging	Het
Pkd1	A	T	17: 24,569,887	D873V	probably benign	Het
Pnpla1	A	G	17: 28,881,047	N296S	probably benign	Het
Ppfia3	A	G	7: 45,342,341	V839A	probably damaging	Het
Ppm1j	A	T	3: 104,782,720	Q148L	probably null	Het
Prune2	T	A	19: 17,119,797	N888K	possibly damaging	Het
Sh3bgr	A	G	16: 96,205,866	D12G	probably benign	Het
Snph	T	A	2: 151,601,057	I35F	possibly damaging	Het
Spag17	A	T	3: 100,072,149	D1442V	probably damaging	Het
Spidr	T	C	16: 16,118,903	T113A	probably benign	Het
St13	A	T	15: 81,365,492	N349K	probably damaging	Het
Ttll6	C	T	11: 96,154,604	S549F	possibly damaging	Het
Uap1l1	A	T	2: 25,362,085	S473T	possibly damaging	Het
Vmn1r54	T	C	6: 90,269,440	V112A	possibly damaging	Het
Vmn2r57	G	A	7: 41,428,662	S124L	probably benign	Het
Wasf2	A	T	4: 133,176,564	R28W	probably benign	Het
Wwp2	T	A	8: 107,548,485	N417K	possibly damaging	Het
Zc3h13	A	T	14: 75,339,396	D1648V	probably damaging	Het

Other mutations in Myo1d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:Myo1d	APN	11	80601740	missense	probably benign
IGL01087:Myo1d	APN	11	80682435	missense	probably damaging	1.00
IGL01326:Myo1d	APN	11	80684321	splice site	probably benign
IGL01431:Myo1d	APN	11	80674839	missense	probably damaging	1.00
IGL01595:Myo1d	APN	11	80676110	missense	probably benign	0.00
IGL01811:Myo1d	APN	11	80692997	missense	probably damaging	0.96
IGL02301:Myo1d	APN	11	80676853	missense	probably benign	0.23
IGL02388:Myo1d	APN	11	80637997	nonsense	probably null
IGL02485:Myo1d	APN	11	80666581	missense	probably damaging	1.00
IGL03017:Myo1d	APN	11	80601626	missense	probably benign	0.26
horton	UTSW	11	80674708	missense	probably damaging	1.00
multifaceted	UTSW	11	80693072	missense	probably damaging	1.00
whisper	UTSW	11	80484332	missense	probably damaging	0.99
whisper2	UTSW	11	80666578	missense	probably damaging	1.00
whisper3	UTSW	11	80557521	missense	probably damaging	1.00
R0069:Myo1d	UTSW	11	80637953	missense	probably damaging	1.00
R0069:Myo1d	UTSW	11	80637953	missense	probably damaging	1.00
R0081:Myo1d	UTSW	11	80557523	missense	probably benign	0.00
R0096:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0096:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0244:Myo1d	UTSW	11	80674708	missense	probably damaging	1.00
R0711:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0746:Myo1d	UTSW	11	80586879	missense	possibly damaging	0.94
R1084:Myo1d	UTSW	11	80684395	missense	probably damaging	1.00
R1514:Myo1d	UTSW	11	80685908	missense	probably damaging	0.97
R1676:Myo1d	UTSW	11	80684421	missense	probably damaging	1.00
R1862:Myo1d	UTSW	11	80663048	missense	probably damaging	1.00
R2497:Myo1d	UTSW	11	80674821	missense	probably damaging	1.00
R2512:Myo1d	UTSW	11	80779717	missense	probably benign	0.00
R3425:Myo1d	UTSW	11	80601638	missense	probably benign
R3429:Myo1d	UTSW	11	80682410	missense	probably damaging	1.00
R3917:Myo1d	UTSW	11	80666578	missense	probably damaging	1.00
R3928:Myo1d	UTSW	11	80484261	missense	probably benign	0.09
R4706:Myo1d	UTSW	11	80666641	missense	probably damaging	0.96
R4723:Myo1d	UTSW	11	80779841	utr 5 prime	probably benign
R4924:Myo1d	UTSW	11	80674678	missense	probably damaging	1.00
R5320:Myo1d	UTSW	11	80684323	critical splice donor site	probably null
R5481:Myo1d	UTSW	11	80663095	missense	possibly damaging	0.79
R6214:Myo1d	UTSW	11	80779791	start codon destroyed	probably null	0.98
R6235:Myo1d	UTSW	11	80692944	missense	probably benign	0.23
R6282:Myo1d	UTSW	11	80557512	missense	probably damaging	0.99
R6468:Myo1d	UTSW	11	80557474	missense	probably benign	0.00
R6668:Myo1d	UTSW	11	80583875	intron	probably benign
R6954:Myo1d	UTSW	11	80674957	missense	probably benign	0.21
R7077:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7078:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7080:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7172:Myo1d	UTSW	11	80592795	missense	probably benign	0.16
R7276:Myo1d	UTSW	11	80693072	missense	probably damaging	1.00
R7467:Myo1d	UTSW	11	80586917	missense	probably damaging	1.00
R7650:Myo1d	UTSW	11	80601684	missense	probably benign
R7678:Myo1d	UTSW	11	80676893	missense	possibly damaging	0.80
R7859:Myo1d	UTSW	11	80684377	missense	probably damaging	1.00
R8324:Myo1d	UTSW	11	80557521	missense	probably damaging	1.00
R8329:Myo1d	UTSW	11	80638074	missense	probably benign	0.21
R8474:Myo1d	UTSW	11	80670919	missense	possibly damaging	0.93
R8799:Myo1d	UTSW	11	80684379	missense	probably damaging	1.00
R8810:Myo1d	UTSW	11	80674932	missense	probably damaging	1.00
R8810:Myo1d	UTSW	11	80676932	missense	probably benign	0.30
R8823:Myo1d	UTSW	11	80601745	missense	possibly damaging	0.91
R9221:Myo1d	UTSW	11	80674918	missense	probably damaging	1.00
R9494:Myo1d	UTSW	11	80484267	missense	probably benign	0.02
R9625:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
R9626:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
R9628:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
Z1088:Myo1d	UTSW	11	80674898	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GCCGGATGCTAATTTCACCTTC -3'
(R):5'- CTCCTTACTCCATGAAACTTGTTAAAG -3'

Sequencing Primer
(F):5'- AAAGATGCTTTAATTTGTCCTTGTGG -3'
(R):5'- GGTTAAAATCGTCACCATCGTTGC -3'

Posted On

2016-06-15