Incidental Mutation 'R5042:Il17rd'
ID393268
Institutional Source Beutler Lab
Gene Symbol Il17rd
Ensembl Gene ENSMUSG00000040717
Gene Nameinterleukin 17 receptor D
Synonyms2810004A10Rik, Sef, Sef-S
MMRRC Submission 042632-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5042 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location27038941-27107286 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27096041 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 229 (V229E)
Ref Sequence ENSEMBL: ENSMUSP00000153543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035336] [ENSMUST00000225146] [ENSMUST00000226105]
Predicted Effect probably damaging
Transcript: ENSMUST00000035336
AA Change: V373E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036076
Gene: ENSMUSG00000040717
AA Change: V373E

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:IL17R_D_N 48 169 2.7e-68 PFAM
Pfam:SEFIR 356 511 9.6e-56 PFAM
low complexity region 667 684 N/A INTRINSIC
low complexity region 688 705 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000225146
AA Change: V229E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225829
Predicted Effect probably damaging
Transcript: ENSMUST00000226105
AA Change: V229E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein belonging to the interleukin-17 receptor (IL-17R) protein family. The encoded protein is a component of the interleukin-17 receptor signaling complex, and the interaction between this protein and IL-17R does not require the interleukin. The gene product also affects fibroblast growth factor signaling, inhibiting or stimulating growth through MAPK/ERK signaling. Alternate splicing generates multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and show no obvious phenotype. A subset of mice homozygous for a gene-trapped allele display cochlear nucleus defects and abnormal auditory brainstem responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,502 noncoding transcript Het
4933413J09Rik C A 14: 26,376,281 noncoding transcript Het
Aldh1a2 A G 9: 71,285,004 I413V possibly damaging Het
Alpk2 C T 18: 65,350,508 W143* probably null Het
Anpep G T 7: 79,839,469 N318K probably benign Het
Art5 A T 7: 102,099,465 L10H probably damaging Het
Atg2b T G 12: 105,621,262 H1981P probably benign Het
B3gnt3 T C 8: 71,692,888 T279A probably damaging Het
Bmp10 G T 6: 87,434,057 E277D probably damaging Het
Ccdc180 A G 4: 45,916,255 T191A probably damaging Het
Dars2 T A 1: 161,045,094 probably benign Het
F5 T A 1: 164,219,451 I2160N probably damaging Het
Fndc7 A T 3: 108,862,786 V608D probably damaging Het
Gad1-ps A T 10: 99,445,654 noncoding transcript Het
Gbp2b A G 3: 142,611,463 K527E probably benign Het
Gm10719 T A 9: 3,018,970 F72I probably damaging Het
Hes3 T A 4: 152,287,043 S150C possibly damaging Het
Hp1bp3 T A 4: 138,222,108 M1K probably null Het
Iqch A G 9: 63,496,234 M634T possibly damaging Het
Magel2 C T 7: 62,379,606 R753W unknown Het
Med26 A G 8: 72,497,075 V60A probably damaging Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Nat1 T G 8: 67,491,576 D201E probably benign Het
Nav3 G T 10: 109,769,268 S981R probably benign Het
Nbn C A 4: 15,981,446 L513M probably benign Het
Nfatc3 T C 8: 106,108,125 V701A probably benign Het
Nlrp9a A G 7: 26,571,278 D911G probably damaging Het
Npr2 A T 4: 43,647,002 I712F probably damaging Het
Olfr514 A G 7: 108,825,471 I176T possibly damaging Het
Oplah G A 15: 76,305,709 R235* probably null Het
Pcdha11 T A 18: 37,011,596 Y247N probably damaging Het
Pcdhga9 A G 18: 37,737,577 Y153C probably damaging Het
Pkd1 A T 17: 24,569,887 D873V probably benign Het
Pnpla1 A G 17: 28,881,047 N296S probably benign Het
Ppfia3 A G 7: 45,342,341 V839A probably damaging Het
Ppm1j A T 3: 104,782,720 Q148L probably null Het
Prune2 T A 19: 17,119,797 N888K possibly damaging Het
Sh3bgr A G 16: 96,205,866 D12G probably benign Het
Snph T A 2: 151,601,057 I35F possibly damaging Het
Spag17 A T 3: 100,072,149 D1442V probably damaging Het
Spidr T C 16: 16,118,903 T113A probably benign Het
St13 A T 15: 81,365,492 N349K probably damaging Het
Ttll6 C T 11: 96,154,604 S549F possibly damaging Het
Uap1l1 A T 2: 25,362,085 S473T possibly damaging Het
Vmn1r54 T C 6: 90,269,440 V112A possibly damaging Het
Vmn2r57 G A 7: 41,428,662 S124L probably benign Het
Wasf2 A T 4: 133,176,564 R28W probably benign Het
Wwp2 T A 8: 107,548,485 N417K possibly damaging Het
Zc3h13 A T 14: 75,339,396 D1648V probably damaging Het
Other mutations in Il17rd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Il17rd APN 14 27095944 missense probably damaging 1.00
IGL02274:Il17rd APN 14 27099910 missense probably damaging 1.00
IGL02732:Il17rd APN 14 27087419 missense probably damaging 1.00
IGL03118:Il17rd APN 14 27093395 critical splice acceptor site probably null
IGL03175:Il17rd APN 14 27100006 missense probably damaging 1.00
FR4304:Il17rd UTSW 14 27082680 utr 5 prime probably benign
FR4449:Il17rd UTSW 14 27082678 utr 5 prime probably benign
FR4737:Il17rd UTSW 14 27082680 utr 5 prime probably benign
FR4976:Il17rd UTSW 14 27082677 utr 5 prime probably benign
R0063:Il17rd UTSW 14 27082733 missense probably damaging 1.00
R0063:Il17rd UTSW 14 27082734 nonsense probably null
R0076:Il17rd UTSW 14 27094854 missense probably damaging 1.00
R0452:Il17rd UTSW 14 27091931 missense probably damaging 1.00
R1540:Il17rd UTSW 14 27099958 missense probably damaging 1.00
R1760:Il17rd UTSW 14 27091806 nonsense probably null
R2192:Il17rd UTSW 14 27094878 missense probably damaging 1.00
R2886:Il17rd UTSW 14 27099553 missense probably damaging 1.00
R3688:Il17rd UTSW 14 27039148 missense probably null 0.14
R4534:Il17rd UTSW 14 27096062 missense probably damaging 0.98
R5410:Il17rd UTSW 14 27095911 missense probably damaging 1.00
R5528:Il17rd UTSW 14 27088067 missense possibly damaging 0.94
R5829:Il17rd UTSW 14 27092085 splice site probably null
R5919:Il17rd UTSW 14 27096044 missense probably damaging 0.99
R6305:Il17rd UTSW 14 27095942 missense possibly damaging 0.77
R6739:Il17rd UTSW 14 27099531 missense possibly damaging 0.55
R6829:Il17rd UTSW 14 27087422 nonsense probably null
R7301:Il17rd UTSW 14 27076391 missense possibly damaging 0.62
R7336:Il17rd UTSW 14 27087546 missense probably benign 0.00
R7521:Il17rd UTSW 14 27094866 missense probably benign 0.05
R7649:Il17rd UTSW 14 27039210 missense probably benign 0.22
R7741:Il17rd UTSW 14 27100336 missense probably damaging 1.00
R7814:Il17rd UTSW 14 27100117 missense probably benign 0.20
R8363:Il17rd UTSW 14 27091949 missense probably damaging 1.00
Z1177:Il17rd UTSW 14 27100261 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGATGTCAGCTGCTCCTTTTGG -3'
(R):5'- AGACAGACTCTGGTTTGGAAAG -3'

Sequencing Primer
(F):5'- ATTTCAGCCGTGAGACACTG -3'
(R):5'- GTAAGATTCTAGGTAAGTAGGTTCCC -3'
Posted On2016-06-15