Incidental Mutation 'R5042:St13'
ID393271
Institutional Source Beutler Lab
Gene Symbol St13
Ensembl Gene ENSMUSG00000022403
Gene Namesuppression of tumorigenicity 13
SynonymsHsp70 interacting protein, HSPABP1, PRO0786, 1110007I03Rik, 3110002K08Rik, SNC6, p48
MMRRC Submission 042632-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R5042 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location81363669-81400077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81365492 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 349 (N349K)
Ref Sequence ENSEMBL: ENSMUSP00000023039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023039] [ENSMUST00000023040] [ENSMUST00000172107] [ENSMUST00000230309] [ENSMUST00000231140]
Predicted Effect probably damaging
Transcript: ENSMUST00000023039
AA Change: N349K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023039
Gene: ENSMUSG00000022403
AA Change: N349K

DomainStartEndE-ValueType
PDB:4J8C|B 1 44 6e-25 PDB
low complexity region 52 72 N/A INTRINSIC
TPR 104 137 1.2e1 SMART
TPR 138 171 6.95e-4 SMART
TPR 172 205 4.8e1 SMART
coiled coil region 225 264 N/A INTRINSIC
low complexity region 271 305 N/A INTRINSIC
STI1 312 351 3.37e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000023040
SMART Domains Protein: ENSMUSP00000023040
Gene: ENSMUSG00000022404

DomainStartEndE-ValueType
Pfam:Mito_carr 6 97 1e-17 PFAM
Pfam:Mito_carr 97 197 6.3e-24 PFAM
Pfam:Mito_carr 199 297 3.2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172107
AA Change: N358K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130195
Gene: ENSMUSG00000022403
AA Change: N358K

DomainStartEndE-ValueType
PDB:4J8C|B 1 44 6e-25 PDB
low complexity region 52 66 N/A INTRINSIC
low complexity region 71 81 N/A INTRINSIC
TPR 113 146 1.2e1 SMART
TPR 147 180 6.95e-4 SMART
TPR 181 214 4.8e1 SMART
coiled coil region 234 273 N/A INTRINSIC
low complexity region 280 314 N/A INTRINSIC
STI1 321 360 3.37e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229617
Predicted Effect probably benign
Transcript: ENSMUST00000230309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231078
Predicted Effect probably benign
Transcript: ENSMUST00000231140
Meta Mutation Damage Score 0.0607 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an adaptor protein that mediates the association of the heat shock proteins HSP70 and HSP90. This protein has been shown to be involved in the assembly process of glucocorticoid receptor, which requires the assistance of multiple molecular chaperones. The expression of this gene is reported to be downregulated in colorectal carcinoma tissue suggesting that it is a candidate tumor suppressor gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,502 noncoding transcript Het
4933413J09Rik C A 14: 26,376,281 noncoding transcript Het
Aldh1a2 A G 9: 71,285,004 I413V possibly damaging Het
Alpk2 C T 18: 65,350,508 W143* probably null Het
Anpep G T 7: 79,839,469 N318K probably benign Het
Art5 A T 7: 102,099,465 L10H probably damaging Het
Atg2b T G 12: 105,621,262 H1981P probably benign Het
B3gnt3 T C 8: 71,692,888 T279A probably damaging Het
Bmp10 G T 6: 87,434,057 E277D probably damaging Het
Ccdc180 A G 4: 45,916,255 T191A probably damaging Het
Dars2 T A 1: 161,045,094 probably benign Het
F5 T A 1: 164,219,451 I2160N probably damaging Het
Fndc7 A T 3: 108,862,786 V608D probably damaging Het
Gad1-ps A T 10: 99,445,654 noncoding transcript Het
Gbp2b A G 3: 142,611,463 K527E probably benign Het
Gm10719 T A 9: 3,018,970 F72I probably damaging Het
Hes3 T A 4: 152,287,043 S150C possibly damaging Het
Hp1bp3 T A 4: 138,222,108 M1K probably null Het
Il17rd T A 14: 27,096,041 V229E probably damaging Het
Iqch A G 9: 63,496,234 M634T possibly damaging Het
Magel2 C T 7: 62,379,606 R753W unknown Het
Med26 A G 8: 72,497,075 V60A probably damaging Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Nat1 T G 8: 67,491,576 D201E probably benign Het
Nav3 G T 10: 109,769,268 S981R probably benign Het
Nbn C A 4: 15,981,446 L513M probably benign Het
Nfatc3 T C 8: 106,108,125 V701A probably benign Het
Nlrp9a A G 7: 26,571,278 D911G probably damaging Het
Npr2 A T 4: 43,647,002 I712F probably damaging Het
Olfr514 A G 7: 108,825,471 I176T possibly damaging Het
Oplah G A 15: 76,305,709 R235* probably null Het
Pcdha11 T A 18: 37,011,596 Y247N probably damaging Het
Pcdhga9 A G 18: 37,737,577 Y153C probably damaging Het
Pkd1 A T 17: 24,569,887 D873V probably benign Het
Pnpla1 A G 17: 28,881,047 N296S probably benign Het
Ppfia3 A G 7: 45,342,341 V839A probably damaging Het
Ppm1j A T 3: 104,782,720 Q148L probably null Het
Prune2 T A 19: 17,119,797 N888K possibly damaging Het
Sh3bgr A G 16: 96,205,866 D12G probably benign Het
Snph T A 2: 151,601,057 I35F possibly damaging Het
Spag17 A T 3: 100,072,149 D1442V probably damaging Het
Spidr T C 16: 16,118,903 T113A probably benign Het
Ttll6 C T 11: 96,154,604 S549F possibly damaging Het
Uap1l1 A T 2: 25,362,085 S473T possibly damaging Het
Vmn1r54 T C 6: 90,269,440 V112A possibly damaging Het
Vmn2r57 G A 7: 41,428,662 S124L probably benign Het
Wasf2 A T 4: 133,176,564 R28W probably benign Het
Wwp2 T A 8: 107,548,485 N417K possibly damaging Het
Zc3h13 A T 14: 75,339,396 D1648V probably damaging Het
Other mutations in St13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:St13 APN 15 81371507 missense probably damaging 0.99
IGL01933:St13 APN 15 81389698 critical splice acceptor site probably null
IGL02152:St13 APN 15 81366382 missense probably damaging 1.00
R0714:St13 UTSW 15 81383027 missense probably benign 0.16
R3417:St13 UTSW 15 81369450 splice site probably benign
R4845:St13 UTSW 15 81399585 missense probably benign 0.09
R4925:St13 UTSW 15 81399585 missense probably benign 0.09
R4934:St13 UTSW 15 81399585 missense probably benign 0.09
R5029:St13 UTSW 15 81399585 missense probably benign 0.09
R5048:St13 UTSW 15 81399585 missense probably benign 0.09
R5139:St13 UTSW 15 81399585 missense probably benign 0.09
R5970:St13 UTSW 15 81377798 missense probably damaging 0.99
R6158:St13 UTSW 15 81399601 splice site probably null
R6175:St13 UTSW 15 81399305 critical splice donor site probably null
R6872:St13 UTSW 15 81366346 critical splice donor site probably null
R7320:St13 UTSW 15 81389653 missense probably damaging 0.99
R7912:St13 UTSW 15 81399518 missense possibly damaging 0.52
X0065:St13 UTSW 15 81366436 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGCCGCATTTGATGTAGAGG -3'
(R):5'- TGGCTGAAGCATTTTACAGTG -3'

Sequencing Primer
(F):5'- AGGGTAGGGATTATCTTCGAAGC -3'
(R):5'- AAATCCTAAAGTTCATCCATTGGCC -3'
Posted On2016-06-15