Incidental Mutation 'R5042:Spidr'
ID393272
Institutional Source Beutler Lab
Gene Symbol Spidr
Ensembl Gene ENSMUSG00000041974
Gene Namescaffolding protein involved in DNA repair
Synonyms2310008H04Rik
MMRRC Submission 042632-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5042 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location15889224-16146851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16118903 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 113 (T113A)
Ref Sequence ENSEMBL: ENSMUSP00000038820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040248]
Predicted Effect probably benign
Transcript: ENSMUST00000040248
AA Change: T113A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000038820
Gene: ENSMUSG00000041974
AA Change: T113A

DomainStartEndE-ValueType
Pfam:DUF4502 11 390 1.8e-177 PFAM
low complexity region 499 508 N/A INTRINSIC
Pfam:DUF4503 540 921 2.2e-179 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229846
Meta Mutation Damage Score 0.0635 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,502 noncoding transcript Het
4933413J09Rik C A 14: 26,376,281 noncoding transcript Het
Aldh1a2 A G 9: 71,285,004 I413V possibly damaging Het
Alpk2 C T 18: 65,350,508 W143* probably null Het
Anpep G T 7: 79,839,469 N318K probably benign Het
Art5 A T 7: 102,099,465 L10H probably damaging Het
Atg2b T G 12: 105,621,262 H1981P probably benign Het
B3gnt3 T C 8: 71,692,888 T279A probably damaging Het
Bmp10 G T 6: 87,434,057 E277D probably damaging Het
Ccdc180 A G 4: 45,916,255 T191A probably damaging Het
Dars2 T A 1: 161,045,094 probably benign Het
F5 T A 1: 164,219,451 I2160N probably damaging Het
Fndc7 A T 3: 108,862,786 V608D probably damaging Het
Gad1-ps A T 10: 99,445,654 noncoding transcript Het
Gbp2b A G 3: 142,611,463 K527E probably benign Het
Gm10719 T A 9: 3,018,970 F72I probably damaging Het
Hes3 T A 4: 152,287,043 S150C possibly damaging Het
Hp1bp3 T A 4: 138,222,108 M1K probably null Het
Il17rd T A 14: 27,096,041 V229E probably damaging Het
Iqch A G 9: 63,496,234 M634T possibly damaging Het
Magel2 C T 7: 62,379,606 R753W unknown Het
Med26 A G 8: 72,497,075 V60A probably damaging Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Nat1 T G 8: 67,491,576 D201E probably benign Het
Nav3 G T 10: 109,769,268 S981R probably benign Het
Nbn C A 4: 15,981,446 L513M probably benign Het
Nfatc3 T C 8: 106,108,125 V701A probably benign Het
Nlrp9a A G 7: 26,571,278 D911G probably damaging Het
Npr2 A T 4: 43,647,002 I712F probably damaging Het
Olfr514 A G 7: 108,825,471 I176T possibly damaging Het
Oplah G A 15: 76,305,709 R235* probably null Het
Pcdha11 T A 18: 37,011,596 Y247N probably damaging Het
Pcdhga9 A G 18: 37,737,577 Y153C probably damaging Het
Pkd1 A T 17: 24,569,887 D873V probably benign Het
Pnpla1 A G 17: 28,881,047 N296S probably benign Het
Ppfia3 A G 7: 45,342,341 V839A probably damaging Het
Ppm1j A T 3: 104,782,720 Q148L probably null Het
Prune2 T A 19: 17,119,797 N888K possibly damaging Het
Sh3bgr A G 16: 96,205,866 D12G probably benign Het
Snph T A 2: 151,601,057 I35F possibly damaging Het
Spag17 A T 3: 100,072,149 D1442V probably damaging Het
St13 A T 15: 81,365,492 N349K probably damaging Het
Ttll6 C T 11: 96,154,604 S549F possibly damaging Het
Uap1l1 A T 2: 25,362,085 S473T possibly damaging Het
Vmn1r54 T C 6: 90,269,440 V112A possibly damaging Het
Vmn2r57 G A 7: 41,428,662 S124L probably benign Het
Wasf2 A T 4: 133,176,564 R28W probably benign Het
Wwp2 T A 8: 107,548,485 N417K possibly damaging Het
Zc3h13 A T 14: 75,339,396 D1648V probably damaging Het
Other mutations in Spidr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Spidr APN 16 15895578 missense probably damaging 1.00
IGL00482:Spidr APN 16 16114969 missense possibly damaging 0.94
IGL01760:Spidr APN 16 15912560 missense possibly damaging 0.71
IGL02142:Spidr APN 16 16048081 missense probably benign 0.25
IGL02392:Spidr APN 16 15889630 makesense probably null
IGL02430:Spidr APN 16 16114910 missense probably damaging 1.00
IGL03110:Spidr APN 16 15889754 missense probably damaging 1.00
R0011:Spidr UTSW 16 15966603 missense probably benign 0.00
R0504:Spidr UTSW 16 16140072 missense possibly damaging 0.73
R0505:Spidr UTSW 16 16037667 missense probably damaging 1.00
R0541:Spidr UTSW 16 15915365 missense probably damaging 1.00
R0675:Spidr UTSW 16 16037634 missense probably damaging 1.00
R0722:Spidr UTSW 16 15912781 missense probably damaging 1.00
R2005:Spidr UTSW 16 16048049 missense probably damaging 1.00
R2133:Spidr UTSW 16 16053273 missense probably benign 0.04
R2249:Spidr UTSW 16 16118923 missense probably damaging 1.00
R2876:Spidr UTSW 16 15912589 splice site probably null
R3087:Spidr UTSW 16 15968619 missense probably damaging 1.00
R3121:Spidr UTSW 16 16140860 missense probably damaging 1.00
R3765:Spidr UTSW 16 15968640 missense probably benign 0.39
R4896:Spidr UTSW 16 16118942 missense possibly damaging 0.70
R4939:Spidr UTSW 16 16140746 nonsense probably null
R5004:Spidr UTSW 16 16118942 missense possibly damaging 0.70
R5736:Spidr UTSW 16 15897298 missense probably damaging 1.00
R5839:Spidr UTSW 16 16037502 missense probably damaging 1.00
R5970:Spidr UTSW 16 16114869 missense probably damaging 1.00
R6084:Spidr UTSW 16 16140024 missense possibly damaging 0.87
R6386:Spidr UTSW 16 15968560 missense probably benign 0.02
R6572:Spidr UTSW 16 15912516 splice site probably null
R7238:Spidr UTSW 16 15966816 missense probably benign 0.10
R7249:Spidr UTSW 16 15966648 missense probably benign 0.00
R7334:Spidr UTSW 16 16114825 critical splice donor site probably null
R7393:Spidr UTSW 16 16146831 start gained probably benign
R7681:Spidr UTSW 16 15895624 missense probably damaging 1.00
R7818:Spidr UTSW 16 16114865 missense probably damaging 1.00
R8247:Spidr UTSW 16 15968526 critical splice donor site probably null
R8507:Spidr UTSW 16 15968676 missense probably damaging 1.00
X0025:Spidr UTSW 16 15889752 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCAGCCAGGTCTACAAAGT -3'
(R):5'- GTGCTTGTGGCTTTGTCTAAATA -3'

Sequencing Primer
(F):5'- GCCAGGTCTACAAAGTGAGTTCC -3'
(R):5'- AATCTCAGCCCTGCACTTGAGG -3'
Posted On2016-06-15