Incidental Mutation 'R5042:Sh3bgr'
ID393273
Institutional Source Beutler Lab
Gene Symbol Sh3bgr
Ensembl Gene ENSMUSG00000040666
Gene NameSH3-binding domain glutamic acid-rich protein
Synonyms
MMRRC Submission 042632-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R5042 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location96200470-96228933 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96205866 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 12 (D12G)
Ref Sequence ENSEMBL: ENSMUSP00000116740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048770] [ENSMUST00000129904] [ENSMUST00000166952] [ENSMUST00000171181]
Predicted Effect probably benign
Transcript: ENSMUST00000048770
SMART Domains Protein: ENSMUSP00000038110
Gene: ENSMUSG00000040666

DomainStartEndE-ValueType
Pfam:SH3BGR 1 98 1.9e-49 PFAM
low complexity region 120 138 N/A INTRINSIC
low complexity region 160 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129904
AA Change: D12G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000116740
Gene: ENSMUSG00000040666
AA Change: D12G

DomainStartEndE-ValueType
Pfam:SH3BGR 30 119 8.2e-43 PFAM
low complexity region 141 159 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132424
SMART Domains Protein: ENSMUSP00000120614
Gene: ENSMUSG00000040666

DomainStartEndE-ValueType
Pfam:SH3BGR 1 90 7.2e-45 PFAM
Pfam:Glutaredoxin 13 68 4.8e-7 PFAM
low complexity region 97 149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000157060
SMART Domains Protein: ENSMUSP00000116607
Gene: ENSMUSG00000040666

DomainStartEndE-ValueType
low complexity region 41 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166952
SMART Domains Protein: ENSMUSP00000129010
Gene: ENSMUSG00000040666

DomainStartEndE-ValueType
Pfam:SH3BGR 1 98 1.9e-50 PFAM
Pfam:Glutaredoxin 21 76 8.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171181
SMART Domains Protein: ENSMUSP00000126581
Gene: ENSMUSG00000040666

DomainStartEndE-ValueType
Pfam:SH3BGR 1 98 1.9e-49 PFAM
low complexity region 120 138 N/A INTRINSIC
low complexity region 160 212 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,502 noncoding transcript Het
4933413J09Rik C A 14: 26,376,281 noncoding transcript Het
Aldh1a2 A G 9: 71,285,004 I413V possibly damaging Het
Alpk2 C T 18: 65,350,508 W143* probably null Het
Anpep G T 7: 79,839,469 N318K probably benign Het
Art5 A T 7: 102,099,465 L10H probably damaging Het
Atg2b T G 12: 105,621,262 H1981P probably benign Het
B3gnt3 T C 8: 71,692,888 T279A probably damaging Het
Bmp10 G T 6: 87,434,057 E277D probably damaging Het
Ccdc180 A G 4: 45,916,255 T191A probably damaging Het
Dars2 T A 1: 161,045,094 probably benign Het
F5 T A 1: 164,219,451 I2160N probably damaging Het
Fndc7 A T 3: 108,862,786 V608D probably damaging Het
Gad1-ps A T 10: 99,445,654 noncoding transcript Het
Gbp2b A G 3: 142,611,463 K527E probably benign Het
Gm10719 T A 9: 3,018,970 F72I probably damaging Het
Hes3 T A 4: 152,287,043 S150C possibly damaging Het
Hp1bp3 T A 4: 138,222,108 M1K probably null Het
Il17rd T A 14: 27,096,041 V229E probably damaging Het
Iqch A G 9: 63,496,234 M634T possibly damaging Het
Magel2 C T 7: 62,379,606 R753W unknown Het
Med26 A G 8: 72,497,075 V60A probably damaging Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Nat1 T G 8: 67,491,576 D201E probably benign Het
Nav3 G T 10: 109,769,268 S981R probably benign Het
Nbn C A 4: 15,981,446 L513M probably benign Het
Nfatc3 T C 8: 106,108,125 V701A probably benign Het
Nlrp9a A G 7: 26,571,278 D911G probably damaging Het
Npr2 A T 4: 43,647,002 I712F probably damaging Het
Olfr514 A G 7: 108,825,471 I176T possibly damaging Het
Oplah G A 15: 76,305,709 R235* probably null Het
Pcdha11 T A 18: 37,011,596 Y247N probably damaging Het
Pcdhga9 A G 18: 37,737,577 Y153C probably damaging Het
Pkd1 A T 17: 24,569,887 D873V probably benign Het
Pnpla1 A G 17: 28,881,047 N296S probably benign Het
Ppfia3 A G 7: 45,342,341 V839A probably damaging Het
Ppm1j A T 3: 104,782,720 Q148L probably null Het
Prune2 T A 19: 17,119,797 N888K possibly damaging Het
Snph T A 2: 151,601,057 I35F possibly damaging Het
Spag17 A T 3: 100,072,149 D1442V probably damaging Het
Spidr T C 16: 16,118,903 T113A probably benign Het
St13 A T 15: 81,365,492 N349K probably damaging Het
Ttll6 C T 11: 96,154,604 S549F possibly damaging Het
Uap1l1 A T 2: 25,362,085 S473T possibly damaging Het
Vmn1r54 T C 6: 90,269,440 V112A possibly damaging Het
Vmn2r57 G A 7: 41,428,662 S124L probably benign Het
Wasf2 A T 4: 133,176,564 R28W probably benign Het
Wwp2 T A 8: 107,548,485 N417K possibly damaging Het
Zc3h13 A T 14: 75,339,396 D1648V probably damaging Het
Other mutations in Sh3bgr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Sh3bgr APN 16 96206490 missense probably damaging 1.00
IGL01404:Sh3bgr APN 16 96206490 missense probably damaging 1.00
R0201:Sh3bgr UTSW 16 96228517 unclassified probably benign
R5203:Sh3bgr UTSW 16 96224520 unclassified probably benign
R5434:Sh3bgr UTSW 16 96224544 unclassified probably benign
R5441:Sh3bgr UTSW 16 96205917 missense possibly damaging 0.68
R6563:Sh3bgr UTSW 16 96205943 splice site probably null
R6869:Sh3bgr UTSW 16 96206660 missense probably damaging 1.00
R6873:Sh3bgr UTSW 16 96206491 missense probably damaging 1.00
R7260:Sh3bgr UTSW 16 96224481 missense unknown
R7373:Sh3bgr UTSW 16 96205835 missense unknown
R7382:Sh3bgr UTSW 16 96205893 missense probably benign 0.04
R7459:Sh3bgr UTSW 16 96205922 missense probably benign 0.02
R8241:Sh3bgr UTSW 16 96223870 missense unknown
R8268:Sh3bgr UTSW 16 96224474 missense unknown
R8396:Sh3bgr UTSW 16 96206480 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGCCACAGGATAAACAGCTC -3'
(R):5'- GGACAATGCCTTTCCTCTCTGG -3'

Sequencing Primer
(F):5'- AGGATAAACAGCTCTCCTTATCTC -3'
(R):5'- TCTGGTGGGTCCCCTCAC -3'
Posted On2016-06-15