Incidental Mutation 'R5042:Pnpla1'
ID393276
Institutional Source Beutler Lab
Gene Symbol Pnpla1
Ensembl Gene ENSMUSG00000043286
Gene Namepatatin-like phospholipase domain containing 1
Synonyms
MMRRC Submission 042632-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R5042 (G1)
Quality Score178
Status Validated
Chromosome17
Chromosomal Location28858411-28890308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28881047 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 296 (N296S)
Ref Sequence ENSEMBL: ENSMUSP00000110385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056866] [ENSMUST00000114737]
Predicted Effect probably benign
Transcript: ENSMUST00000056866
AA Change: N296S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050123
Gene: ENSMUSG00000043286
AA Change: N296S

DomainStartEndE-ValueType
Pfam:Patatin 16 183 1.4e-14 PFAM
low complexity region 443 454 N/A INTRINSIC
low complexity region 462 479 N/A INTRINSIC
low complexity region 549 564 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114737
AA Change: N296S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110385
Gene: ENSMUSG00000043286
AA Change: N296S

DomainStartEndE-ValueType
Pfam:Patatin 16 183 9.3e-15 PFAM
low complexity region 443 454 N/A INTRINSIC
low complexity region 462 479 N/A INTRINSIC
low complexity region 549 564 N/A INTRINSIC
Meta Mutation Damage Score 0.1104 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the patatin-like phospholipase (PNPLA) family, which is characterized by the presence of a highly conserved patatin domain. PNPLA family members have diverse lipolytic and acyltransferase activities, and are key elements in lipid metabolism. While other members of this family have been well characterized, the function of this gene remained an enigma. However, recent studies show that this gene is expressed in the skin epidermal keratinocytes, and has a role in glycerophospholipid metabolism in the cutaneous barrier. Consistent with these observations, mutations in this gene are associated with ichthyosis in human (autosomal recessive congenital ichthyoses, ARCI) and dog. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality; shiny, red, dry, wrinkled and non-elastic skin; reduced size and weight at birth; fail to suckle; and exhibit skin defects associated with a lack of omega-O-acylceramides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,502 noncoding transcript Het
4933413J09Rik C A 14: 26,376,281 noncoding transcript Het
Aldh1a2 A G 9: 71,285,004 I413V possibly damaging Het
Alpk2 C T 18: 65,350,508 W143* probably null Het
Anpep G T 7: 79,839,469 N318K probably benign Het
Art5 A T 7: 102,099,465 L10H probably damaging Het
Atg2b T G 12: 105,621,262 H1981P probably benign Het
B3gnt3 T C 8: 71,692,888 T279A probably damaging Het
Bmp10 G T 6: 87,434,057 E277D probably damaging Het
Ccdc180 A G 4: 45,916,255 T191A probably damaging Het
Dars2 T A 1: 161,045,094 probably benign Het
F5 T A 1: 164,219,451 I2160N probably damaging Het
Fndc7 A T 3: 108,862,786 V608D probably damaging Het
Gad1-ps A T 10: 99,445,654 noncoding transcript Het
Gbp2b A G 3: 142,611,463 K527E probably benign Het
Gm10719 T A 9: 3,018,970 F72I probably damaging Het
Hes3 T A 4: 152,287,043 S150C possibly damaging Het
Hp1bp3 T A 4: 138,222,108 M1K probably null Het
Il17rd T A 14: 27,096,041 V229E probably damaging Het
Iqch A G 9: 63,496,234 M634T possibly damaging Het
Magel2 C T 7: 62,379,606 R753W unknown Het
Med26 A G 8: 72,497,075 V60A probably damaging Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Nat1 T G 8: 67,491,576 D201E probably benign Het
Nav3 G T 10: 109,769,268 S981R probably benign Het
Nbn C A 4: 15,981,446 L513M probably benign Het
Nfatc3 T C 8: 106,108,125 V701A probably benign Het
Nlrp9a A G 7: 26,571,278 D911G probably damaging Het
Npr2 A T 4: 43,647,002 I712F probably damaging Het
Olfr514 A G 7: 108,825,471 I176T possibly damaging Het
Oplah G A 15: 76,305,709 R235* probably null Het
Pcdha11 T A 18: 37,011,596 Y247N probably damaging Het
Pcdhga9 A G 18: 37,737,577 Y153C probably damaging Het
Pkd1 A T 17: 24,569,887 D873V probably benign Het
Ppfia3 A G 7: 45,342,341 V839A probably damaging Het
Ppm1j A T 3: 104,782,720 Q148L probably null Het
Prune2 T A 19: 17,119,797 N888K possibly damaging Het
Sh3bgr A G 16: 96,205,866 D12G probably benign Het
Snph T A 2: 151,601,057 I35F possibly damaging Het
Spag17 A T 3: 100,072,149 D1442V probably damaging Het
Spidr T C 16: 16,118,903 T113A probably benign Het
St13 A T 15: 81,365,492 N349K probably damaging Het
Ttll6 C T 11: 96,154,604 S549F possibly damaging Het
Uap1l1 A T 2: 25,362,085 S473T possibly damaging Het
Vmn1r54 T C 6: 90,269,440 V112A possibly damaging Het
Vmn2r57 G A 7: 41,428,662 S124L probably benign Het
Wasf2 A T 4: 133,176,564 R28W probably benign Het
Wwp2 T A 8: 107,548,485 N417K possibly damaging Het
Zc3h13 A T 14: 75,339,396 D1648V probably damaging Het
Other mutations in Pnpla1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Pnpla1 APN 17 28877442 missense probably damaging 1.00
IGL01713:Pnpla1 APN 17 28881605 missense possibly damaging 0.46
IGL02972:Pnpla1 APN 17 28886947 missense probably null 0.65
IGL03350:Pnpla1 APN 17 28876992 missense probably damaging 1.00
R0335:Pnpla1 UTSW 17 28886878 missense possibly damaging 0.48
R1727:Pnpla1 UTSW 17 28878534 missense probably benign 0.30
R3620:Pnpla1 UTSW 17 28877388 missense probably damaging 1.00
R3621:Pnpla1 UTSW 17 28877388 missense probably damaging 1.00
R4831:Pnpla1 UTSW 17 28878544 missense probably benign 0.28
R5011:Pnpla1 UTSW 17 28885584 missense possibly damaging 0.57
R5068:Pnpla1 UTSW 17 28879423 splice site probably null
R5690:Pnpla1 UTSW 17 28878372 missense probably damaging 1.00
R5886:Pnpla1 UTSW 17 28876863 missense possibly damaging 0.63
R6269:Pnpla1 UTSW 17 28881368 missense probably benign 0.00
R6270:Pnpla1 UTSW 17 28881368 missense probably benign 0.00
R6271:Pnpla1 UTSW 17 28881368 missense probably benign 0.00
R6272:Pnpla1 UTSW 17 28881368 missense probably benign 0.00
R6369:Pnpla1 UTSW 17 28878481 missense probably damaging 1.00
R6611:Pnpla1 UTSW 17 28881047 missense probably benign
R6962:Pnpla1 UTSW 17 28878481 missense probably damaging 1.00
R7359:Pnpla1 UTSW 17 28881185 missense probably benign 0.25
R7400:Pnpla1 UTSW 17 28858976 missense probably damaging 1.00
R7444:Pnpla1 UTSW 17 28878481 missense possibly damaging 0.95
R7507:Pnpla1 UTSW 17 28876817 missense probably damaging 1.00
R7513:Pnpla1 UTSW 17 28858807 start gained probably benign
X0019:Pnpla1 UTSW 17 28881067 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACGCTGTGCCCATCATGTATC -3'
(R):5'- TTGCTTGGATATAGAGACCCGTAG -3'

Sequencing Primer
(F):5'- TGTAGATTTTGCAGACACACCC -3'
(R):5'- TAGTGACACGGGTGATTCCAC -3'
Posted On2016-06-15