Mutagenetix > Incidental Mutation

Incidental Mutation 'R5042:Alpk2'

393279

Institutional Source

Beutler Lab

Gene Symbol

Alpk2

Ensembl Gene

ENSMUSG00000032845

Gene Name

alpha-kinase 2

Synonyms

Hak

MMRRC Submission

042632-MU

Accession Numbers

Genbank: NM_001037294

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5042 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65265529-65393888 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 65350508 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 143 (W143*)

Ref Sequence

ENSEMBL: ENSMUSP00000048752 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035548] [ENSMUST00000141250]

AlphaFold

Q91ZB0

Predicted Effect

probably null
Transcript: ENSMUST00000035548
AA Change: W143*

SMART Domains

Protein: ENSMUSP00000048752
Gene: ENSMUSG00000032845
AA Change: W143*

Domain	Start	End	E-Value	Type
IGc2	24	94	9.34e-4	SMART
low complexity region	196	209	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	1025	1037	N/A	INTRINSIC
low complexity region	1337	1353	N/A	INTRINSIC
IG	1766	1849	2.27e-2	SMART
Alpha_kinase	1879	2098	3.72e-79	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000141250

SMART Domains

Protein: ENSMUSP00000114658
Gene: ENSMUSG00000032845

Domain	Start	End	E-Value	Type
low complexity region	255	267	N/A	INTRINSIC
low complexity region	558	570	N/A	INTRINSIC
low complexity region	870	886	N/A	INTRINSIC
IG	1299	1382	2.27e-2	SMART
Alpha_kinase	1412	1603	2.45e-56	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 89.8%

Validation Efficiency

100% (57/57)

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	T	A	7: 29,574,502		noncoding transcript	Het
4933413J09Rik	C	A	14: 26,376,281		noncoding transcript	Het
Aldh1a2	A	G	9: 71,285,004	I413V	possibly damaging	Het
Anpep	G	T	7: 79,839,469	N318K	probably benign	Het
Art5	A	T	7: 102,099,465	L10H	probably damaging	Het
Atg2b	T	G	12: 105,621,262	H1981P	probably benign	Het
B3gnt3	T	C	8: 71,692,888	T279A	probably damaging	Het
Bmp10	G	T	6: 87,434,057	E277D	probably damaging	Het
Ccdc180	A	G	4: 45,916,255	T191A	probably damaging	Het
Dars2	T	A	1: 161,045,094		probably benign	Het
F5	T	A	1: 164,219,451	I2160N	probably damaging	Het
Fndc7	A	T	3: 108,862,786	V608D	probably damaging	Het
Gad1-ps	A	T	10: 99,445,654		noncoding transcript	Het
Gbp2b	A	G	3: 142,611,463	K527E	probably benign	Het
Gm10719	T	A	9: 3,018,970	F72I	probably damaging	Het
Hes3	T	A	4: 152,287,043	S150C	possibly damaging	Het
Hp1bp3	T	A	4: 138,222,108	M1K	probably null	Het
Il17rd	T	A	14: 27,096,041	V229E	probably damaging	Het
Iqch	A	G	9: 63,496,234	M634T	possibly damaging	Het
Magel2	C	T	7: 62,379,606	R753W	unknown	Het
Med26	A	G	8: 72,497,075	V60A	probably damaging	Het
Myo1d	T	A	11: 80,557,521	D926V	probably damaging	Het
Nat1	T	G	8: 67,491,576	D201E	probably benign	Het
Nav3	G	T	10: 109,769,268	S981R	probably benign	Het
Nbn	C	A	4: 15,981,446	L513M	probably benign	Het
Nfatc3	T	C	8: 106,108,125	V701A	probably benign	Het
Nlrp9a	A	G	7: 26,571,278	D911G	probably damaging	Het
Npr2	A	T	4: 43,647,002	I712F	probably damaging	Het
Olfr514	A	G	7: 108,825,471	I176T	possibly damaging	Het
Oplah	G	A	15: 76,305,709	R235*	probably null	Het
Pcdha11	T	A	18: 37,011,596	Y247N	probably damaging	Het
Pcdhga9	A	G	18: 37,737,577	Y153C	probably damaging	Het
Pkd1	A	T	17: 24,569,887	D873V	probably benign	Het
Pnpla1	A	G	17: 28,881,047	N296S	probably benign	Het
Ppfia3	A	G	7: 45,342,341	V839A	probably damaging	Het
Ppm1j	A	T	3: 104,782,720	Q148L	probably null	Het
Prune2	T	A	19: 17,119,797	N888K	possibly damaging	Het
Sh3bgr	A	G	16: 96,205,866	D12G	probably benign	Het
Snph	T	A	2: 151,601,057	I35F	possibly damaging	Het
Spag17	A	T	3: 100,072,149	D1442V	probably damaging	Het
Spidr	T	C	16: 16,118,903	T113A	probably benign	Het
St13	A	T	15: 81,365,492	N349K	probably damaging	Het
Ttll6	C	T	11: 96,154,604	S549F	possibly damaging	Het
Uap1l1	A	T	2: 25,362,085	S473T	possibly damaging	Het
Vmn1r54	T	C	6: 90,269,440	V112A	possibly damaging	Het
Vmn2r57	G	A	7: 41,428,662	S124L	probably benign	Het
Wasf2	A	T	4: 133,176,564	R28W	probably benign	Het
Wwp2	T	A	8: 107,548,485	N417K	possibly damaging	Het
Zc3h13	A	T	14: 75,339,396	D1648V	probably damaging	Het

Other mutations in Alpk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Alpk2	APN	18	65305823	missense	probably benign	0.27
IGL00478:Alpk2	APN	18	65307226	nonsense	probably null
IGL00898:Alpk2	APN	18	65350573	missense	probably benign	0.29
IGL00978:Alpk2	APN	18	65291534	splice site	probably benign
IGL01093:Alpk2	APN	18	65349329	missense	probably damaging	0.98
IGL01094:Alpk2	APN	18	65306602	missense	probably damaging	0.96
IGL01109:Alpk2	APN	18	65307140	missense	probably benign	0.09
IGL01370:Alpk2	APN	18	65350591	missense	possibly damaging	0.56
IGL01393:Alpk2	APN	18	65307708	missense	possibly damaging	0.88
IGL01629:Alpk2	APN	18	65300042	missense	probably damaging	1.00
IGL01872:Alpk2	APN	18	65304753	missense	probably benign	0.01
IGL01983:Alpk2	APN	18	65350682	missense	probably damaging	1.00
IGL02294:Alpk2	APN	18	65306075	missense	possibly damaging	0.45
IGL02333:Alpk2	APN	18	65349480	missense	probably damaging	0.99
IGL02493:Alpk2	APN	18	65350331	missense	probably benign	0.02
IGL02551:Alpk2	APN	18	65372751	missense	probably damaging	1.00
IGL02864:Alpk2	APN	18	65307599	missense	probably benign	0.12
IGL02901:Alpk2	APN	18	65306411	missense	probably benign
IGL02954:Alpk2	APN	18	65306136	missense	probably benign
IGL03257:Alpk2	APN	18	65349874	missense	probably damaging	0.99
IGL03389:Alpk2	APN	18	65304866	missense	possibly damaging	0.92
3-1:Alpk2	UTSW	18	65304888	missense	probably damaging	0.99
PIT4131001:Alpk2	UTSW	18	65306379	missense	possibly damaging	0.84
R0098:Alpk2	UTSW	18	65349911	missense	probably damaging	1.00
R0098:Alpk2	UTSW	18	65349911	missense	probably damaging	1.00
R0414:Alpk2	UTSW	18	65306159	missense	probably benign	0.04
R0546:Alpk2	UTSW	18	65306717	missense	probably benign	0.05
R0628:Alpk2	UTSW	18	65307296	missense	possibly damaging	0.94
R0658:Alpk2	UTSW	18	65349487	missense	probably damaging	1.00
R0731:Alpk2	UTSW	18	65305390	missense	probably damaging	0.98
R0919:Alpk2	UTSW	18	65307473	missense	probably benign
R1069:Alpk2	UTSW	18	65305014	missense	probably benign	0.25
R1186:Alpk2	UTSW	18	65294341	critical splice acceptor site	probably null
R1508:Alpk2	UTSW	18	65349305	missense	probably damaging	1.00
R1535:Alpk2	UTSW	18	65350204	missense	probably benign
R1558:Alpk2	UTSW	18	65350230	missense	probably benign
R1600:Alpk2	UTSW	18	65378037	missense	probably damaging	0.96
R1664:Alpk2	UTSW	18	65349873	missense	probably damaging	0.96
R1672:Alpk2	UTSW	18	65280959	missense	probably damaging	1.00
R1829:Alpk2	UTSW	18	65294094	missense	possibly damaging	0.75
R2110:Alpk2	UTSW	18	65307080	missense	possibly damaging	0.94
R2111:Alpk2	UTSW	18	65349774	missense	probably benign
R2113:Alpk2	UTSW	18	65305683	missense	probably benign	0.31
R2126:Alpk2	UTSW	18	65350368	nonsense	probably null
R2198:Alpk2	UTSW	18	65350184	missense	probably benign	0.42
R2227:Alpk2	UTSW	18	65378076	missense	probably damaging	1.00
R2245:Alpk2	UTSW	18	65305163	missense	probably benign	0.02
R2282:Alpk2	UTSW	18	65307626	missense	probably benign
R2421:Alpk2	UTSW	18	65306616	missense	probably benign	0.00
R2512:Alpk2	UTSW	18	65350520	missense	probably damaging	0.96
R3105:Alpk2	UTSW	18	65350210	missense	possibly damaging	0.57
R3700:Alpk2	UTSW	18	65305151	missense	probably damaging	0.99
R4205:Alpk2	UTSW	18	65305211	missense	possibly damaging	0.76
R4239:Alpk2	UTSW	18	65300141	missense	probably damaging	1.00
R4353:Alpk2	UTSW	18	65291452	missense	possibly damaging	0.73
R4572:Alpk2	UTSW	18	65281004	missense	probably damaging	1.00
R4584:Alpk2	UTSW	18	65306964	missense	probably damaging	0.99
R4591:Alpk2	UTSW	18	65305823	missense	probably benign	0.27
R4595:Alpk2	UTSW	18	65289748	missense	probably damaging	1.00
R4648:Alpk2	UTSW	18	65349882	missense	probably damaging	0.99
R4815:Alpk2	UTSW	18	65349955	missense	probably damaging	1.00
R4828:Alpk2	UTSW	18	65349113	missense	probably benign
R4910:Alpk2	UTSW	18	65266286	nonsense	probably null
R5295:Alpk2	UTSW	18	65305038	missense	probably damaging	0.98
R5375:Alpk2	UTSW	18	65372738	missense	probably damaging	1.00
R5475:Alpk2	UTSW	18	65307012	missense	probably benign	0.16
R5480:Alpk2	UTSW	18	65349908	missense	probably damaging	1.00
R5486:Alpk2	UTSW	18	65294354	splice site	probably null
R5503:Alpk2	UTSW	18	65306241	missense	probably benign	0.00
R5595:Alpk2	UTSW	18	65266248	missense	probably damaging	1.00
R5648:Alpk2	UTSW	18	65349917	missense	probably damaging	0.96
R5714:Alpk2	UTSW	18	65305461	missense	possibly damaging	0.55
R5862:Alpk2	UTSW	18	65307289	missense	probably damaging	1.00
R5894:Alpk2	UTSW	18	65281072	missense	probably damaging	0.99
R5898:Alpk2	UTSW	18	65307623	missense	probably damaging	0.99
R5936:Alpk2	UTSW	18	65350520	missense	probably damaging	0.96
R6142:Alpk2	UTSW	18	65305385	missense	possibly damaging	0.94
R6291:Alpk2	UTSW	18	65305901	missense	possibly damaging	0.93
R6339:Alpk2	UTSW	18	65349806	missense	probably benign	0.00
R6407:Alpk2	UTSW	18	65289738	missense	probably benign	0.22
R6487:Alpk2	UTSW	18	65266183	missense	possibly damaging	0.62
R6667:Alpk2	UTSW	18	65307740	missense	probably damaging	1.00
R6786:Alpk2	UTSW	18	65306634	missense	probably benign
R6833:Alpk2	UTSW	18	65306409	missense	probably benign	0.08
R6984:Alpk2	UTSW	18	65305678	missense	possibly damaging	0.95
R6999:Alpk2	UTSW	18	65304513	missense	probably damaging	0.99
R7157:Alpk2	UTSW	18	65266277	nonsense	probably null
R7167:Alpk2	UTSW	18	65306978	missense	probably benign	0.40
R7225:Alpk2	UTSW	18	65305199	missense	probably benign	0.00
R7409:Alpk2	UTSW	18	65306952	missense	probably benign	0.01
R7533:Alpk2	UTSW	18	65304603	missense	probably damaging	1.00
R7576:Alpk2	UTSW	18	65306816	missense	possibly damaging	0.89
R7589:Alpk2	UTSW	18	65300073	missense	probably damaging	1.00
R7598:Alpk2	UTSW	18	65304566	missense	probably damaging	1.00
R7664:Alpk2	UTSW	18	65307002	missense	probably benign	0.03
R7711:Alpk2	UTSW	18	65306484	missense	probably benign
R7722:Alpk2	UTSW	18	65350157	missense	probably damaging	1.00
R7783:Alpk2	UTSW	18	65306254	nonsense	probably null
R7806:Alpk2	UTSW	18	65349416	missense	probably benign
R7953:Alpk2	UTSW	18	65349830	missense	probably damaging	1.00
R8024:Alpk2	UTSW	18	65305035	missense	probably benign	0.01
R8043:Alpk2	UTSW	18	65349830	missense	probably damaging	1.00
R8063:Alpk2	UTSW	18	65350346	missense	probably benign	0.15
R8171:Alpk2	UTSW	18	65305983	missense	probably benign	0.00
R8280:Alpk2	UTSW	18	65307203	missense	probably benign
R8383:Alpk2	UTSW	18	65305398	missense	probably benign	0.03
R8414:Alpk2	UTSW	18	65307471	missense	possibly damaging	0.89
R8791:Alpk2	UTSW	18	65305526	missense	probably benign	0.00
R8872:Alpk2	UTSW	18	65280906	missense	probably damaging	1.00
R9352:Alpk2	UTSW	18	65306712	missense	probably benign	0.01
R9449:Alpk2	UTSW	18	65291393	missense	probably damaging	1.00
R9525:Alpk2	UTSW	18	65266217	missense	probably damaging	1.00
R9564:Alpk2	UTSW	18	65305943	missense	probably damaging	1.00
R9710:Alpk2	UTSW	18	65349575	missense	probably damaging	1.00
X0023:Alpk2	UTSW	18	65291400	missense	probably damaging	1.00
X0027:Alpk2	UTSW	18	65307471	missense	possibly damaging	0.89
X0063:Alpk2	UTSW	18	65307363	missense	probably benign
X0064:Alpk2	UTSW	18	65349684	missense	probably benign	0.09
Z1176:Alpk2	UTSW	18	65305611	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GCATTCACTGTCCAGAGCTG -3'
(R):5'- TCTCGGCAAGAAACTGCGTG -3'

Sequencing Primer
(F):5'- CCAGAGCTGGGATACATCTTG -3'
(R):5'- AACTGCGTGGGGATGATC -3'

Posted On

2016-06-15